Description :
From Genome Similarity Track
Location :
scaffold_10:49575- 76322
Transcript NameFunction/comments
g644.t1hypothetical protein
g645.t1 hypothetical protein PHYSODRAFT_505149
g646.t1 DNA repair and recombination protein RAD54
g647.t1 hypothetical protein PHYSODRAFT_508492
g648.t1 kinesin-like protein
g649.t1 DEAD/DEAH box RNA helicase putative
g650.t1 hypothetical protein PHYSODRAFT_560612
g651.t1hypothetical protein
g652.t1 hypothetical protein PHYSODRAFT_354854

Sequence
26747 bases(100 bases per row)
GTGTTCAAACAGTAAAAAGCGGACTTGGGCTGTCCGCACGCACGATCGCCATTACCGCACCATCCGAGATCGTAAGGGAGGCAGCGAACTTCCGACCCTG
CGAACAGCACGACGGTCGTCTCCTCATATGCTAGCAATGTGCGTATAGACCCTGTACAGTACATGGTGTTCTTCATCGCTGGCCTCCAACCGAAACGCGT
CCAGTACTACAGTTGTAGTTACGATTCGCTGAGCGAACCCATGTTTCAATAGGGCGACGTCCGTGAAACTTAAGGGTCTGCTATTGGTGGAAAATGCCTT
CCCGCAAACCGCCTGCGCTAGAATCAGGGCTGACTCTCTATCGCACGCTCCACTCACCGATTTGCGTTCCTGGACGGAGTTCAAGCGGTACAACTCAGGT
TTCTCTCGACCCCCCTCTTCCTCGACTCTACAGCCAAGATGGTTCGCGTGCTCGCCCTCTCCGCCGCTGCGGCTATGCTGGTGGCCTCTTCATCGGCGCT
GGACCAGAAGCTCTACGGACTCAACTACGACTTGCGTCAGGGCCCCGACTGGGACGCCGACAAGTGCAAGTCCTCGGACACCATTGCGGCTGACCTCAAG
ATCCTCAGCACCATCACGTCCAACGTGCGCACCTACAGTCTCTCGGACTGCGATGTCACGGGCGTGCTCAAGGCCGCCAAGGACCTCTCGCTCACCGTTT
GGCTCGGTGTCTGGGTGTCTGAGGACTCGAAGGTCTACGACGCCGAGGTCGCGGCCTTCAAGAAGCTCATCACCGCCGGCCTCATTGACAGCAACGTCGT
CGGTATCAACGTGGGCAGCGAGGCTGTGTACCGTGAGGACATCACGGCCGAGCAGGCCATCAAGTACGTGACAGACTTCAAGAAGGTCATGTCGGACAAC
GACATCAGCGTGCCCGTCAGTATCACGGACATCATCGATACGTTCGTCCAGTACCCGGACATGCTCAAGGCTGGTGATATCGTGACCATCAACCAGTTCC
CGTTCTGGGAGAAGATTGAGGCTGACAAGGCCGCGGCTCAGTTCAACAAGCGCATCCAGCCGCTGCTCAAGATGGCCGGCGACATGGAAGTCATCATCAG
CGAGACTGGCTGGCCCACGGGTGGATCAGCGACGAACGGGTCGGTGGCCTCGGAGGAGAACGGTGCTGTCTACTTGAACGACTTCTACGAGTTGGCTGAG
TCCAAGGGCTGGAAGTACTACTACTTCGCGGGTTTTGACACGCCCTACAAGGAGGAGCAGGCGGATGACACGACTACGGTCGAGTCGCACTTCGGCATCT
TCGACGACAAGGGAACGATTAAGCCGGCCTACGAGAGCCTCAAGTTCACCAAGACCGGCGACTTCTCCACCTCGGGAAGCTCGGCTACGACCACCTCGTC
GGGATCGTCCAGCACTTCGGTCGGCGCTGGTACTGTTGCCCCCGGTAGCGGCACTTCTGGCACTACCACCAGCTCCGGCACCAGCGACTCTACCAACACC
CAGTCGTCCTCGAGTTCTGATAAGGCCGGTTCTTCCAGCATTTCGAACGCGGAGAACGGATCGTCGCAGCTTGTGGCTGCCAGCTTCGCTGCCTTTCTTG
GCGTCGTCTCCACTATGTTCTGGAGCCTGTAAGCTGTTTTGTGTTCGCAGGTCTAATGTTTGTAGCTAATTCACGATAGTTACGGTACTTCACTTAGAAA
TTATGTTCTAGACATCATTTCTATTTCGCTTTTTGGTTCGTGTATACTGTATACCGCAGTATTTGCAATGGCTAGCTCCCAGACGAATGAGGCCGCCACT
AGTGATGCCGCAAACGAGGGGCTGCTGGTGCTGGTGATCGACACGAACCCTGTGCACTGGCTCGGGCAGGGCGGGAGTGCGAGTGACCGTGCCGGGCTGC
AGCAGCTGATCTCCAGCACGCTCGTGTTTGTGAACTCGTACCTACTGCTGCATCGCAGCAACCGCATCGTGATCATTGCCGCCCACGCCGGCACAAGCGC
CATGTTGTATCCGGATCTAGAACAGGACGACACTACTGGAAGTGCGGAACAAGCAGCCAGAGTGAATGCTGGGGTCTTGCAGCGCCTGCAACAGCTCAGC
GACGCGCCGCTGGACCCCGCCAAGACAAACCCTACGGCTATTGCAGCATCGTTATCTCGTGCGCTGTGCTGTAAGTTTGGTGCAACGCAAAGAACATTAT
ATCGTGTGTTGGTGTTGACATTGTGGCTGTTGTGTGTGTGCGATGCAGTTATTAATCGAGCTATCAACGAGGAGCCGGATCTTCGACCACGGATCTTGGT
CATTCAAAAGTCTCCAGACGTGTCGGAGCACTACATTGCCATCATGAACGGCATCTTCTCGGCACAGAAGAAGAACGTCGCAGTGGACGCTTGCATCCTC
GCTACGGAACACTCGTCGTTCATGCAGCAGGCAGCATATCTTACTGGCGGGATCTACTACAAACCCAATGACCACAGCGGGCTGCTGCAGTACCTGATCT
CGATCTACCTGCCAAATCCCTCCATGCGCAAGCTGCTCAAACTACCGTCTCAAGACTCGGTCGACTTCCGTGCAATGTGTTTTTGCCATCGCGAGGTCAT
TTCTACGGCTTATGTCTGCCCCGTGTGTCTGTCACTCTTTTGCGAGTTCCGGCCCATCTGCTCCACTTGTGGCATTCGTAGCCACATCCAGCCCAAGAAG
AACGGTCTAAACAAGCGCCAGCGTTTGGCTTAAATAAAAAAATTGCCACTACGGCACGAGTGCATGTAAGCTTACCGACTATCGTATAATATGATTGGCT
GAAAGTCTTCCCGATGGCAAAATCATGATTATGCGCATTTTATAGCGTTATGGTTGGTAGAAAATGCAATTTGCCTTTTGCGGGGCAGACCGACGTCAGC
ACTTGAGCTGCCATACTCAGAATCTCCACGCAGACAGCAGACCCCGACCATGAGCAGGTGGGAGCAGCGTTCGGTCGCCTTCGTGTGGGGTTAGCACTGT
TCTCACCTATTGCCTTGTTTTTGTCATTGCAGACCGACCATCGCTGAGGTTATTGCCGAGCGCAAGGCCAACAACACGGCCGCCTTCATCACCTTCGTGC
CCTGCGGCTTCAAGACCAAGGCTGACACGGTGGATATCCTACTAGGACTGCAGCGTGGCGGTGCCAACATCATCGAGGTTGGCATTCCGTACTCAGACCC
TCAGGCCGATGGTCCGACCATCCAGCGTGCCCACCAGGTGGGTGTGAACCAGGGCATCACTTTGCACGACGTGCTGGCCACTGTTAGCGAAGCGCGCACC
AAGGGCTTGACCACGCCAGTGGTGCTCATGGGATACTACAACAATATCTTTCAGTACGGCGAAGATAAAATCTGCCCTGACGCCCAGAAAGGTACGAACC
TATTACACTGTTGTGCTAGGGCAGTGAGCTGATTCTGGTTTTCTCTTGATGTTGGCAAACGTGCAGCTGGTGTGGACGGGTTCATTATTGTCGACTTGCC
GCCTGAGGAGGCCAAGCCGCTCAGTGACGACGCGGCCAAGCACGGTCTCGCTTACATTCCGTTGGTGTCCCCTACGACGACTGAGGACCGCATGAAGCTC
ATCGACTCGGTGGCGCATGGCTTCGTGTACTGCGTGAGCCTTACTGGTGTCACGGGCGCTCGTAACGAGCTGCCTCCGAATCTCGATGCATTCATGGCAA
AAAGTAAGTCGTGTTTTTCAGGGGATGCTGCGAATATTCCGCTAACGCTTTCGGCTTGATTTACTGCAGTTCGTGCCAACGTGAAGCACCCGCTAGCGCT
GGGCTTCGGTCTGTCGACTCGCCAGCATTTCGTGCAGGCCAGTGCTCTCGCAGACGGTGTCGTGATCGGCTCAAAGATTGTCAAGATCATTGAGGACGCA
CCCGACACTGCCACACGCGCCGCCAACGTGGAGGCTTTTGCCAAGAGCATCGTGAATCCTTAGCTCCACAACGTAGGACTACTGAGCTACAGCGGATACT
CCAAATATACTATACCGTACATCAGACCCTTTTACTTTCGAATTCAAGAATCTGTATATCAGGCAAACTGTGTGCAAAATTCACTGCCAGTAGCCCAGTC
GGCAATGGTGGGCGTCTATGACGCACTTTGGTTGGCGCGAGTTCGAGTCCCACTACGGTCAAAAACTCGCAATTCGTACTTAAAAGAGCAGTTGGTTCCA
TACAATTCGTAGCATACTTCGAAGCCCGGTGTGTCTGTACTATTAGACTAAGGATCGGGTCAATATGTGTGCAATAGTAAAATCCGCGTGTCAGGGTGTC
AGTACTGGGTGATTGGCCAAAATGGTGAATTAGTCTCAGAATCTGCCAATCGACATGCGAATATCTTTTGTCGAAAGGACTCGGATTCACTTCAACTACA
GGACCGATGGACGTGCTGGAGGCTCTGAAGAACGACGGCAACGCGCTGTTTCAGCAGCAGCGATTCACTGAGGCCGTGGAAGTCTACAGCTCTGTGCTCG
ACAAGCTGGAAGACTCGGGGGTTAATGACGAAGTGGCTGCGCGACTTGAGGTGGCGGTGCGACTCAACCGAGCGTGGGCATGGATCCAGATGCCCCACAC
TGAGTCCACTTTACTAACCGCAGAGCAGGACTGCAGCGCGGTGATTAAGAAGGATCCGTCTTGTGTCAAGGCCTTCTATCGGCGAGCGCTGGCACGTGAG
CGCAGAGGGCAATGGAGGGTAGGCTGCGAATGTATTCACAGCTAGAAAGCGTCCTTTGACTGAGCTTGGATGTGTGCTTGTAGTTGGCAATGGATGATGC
AGTCACCATGAGGCAGCTCGAGCCTGGCCATCCTTCAGTTGGCCCGTTGCTCGAGAGACTACAACAGCACACACTAGGAAAAGAAGACCTGGTGCCAAAA
TTTCAGCAGTGCTCAATTAAAAGTGATAACACCAACACTTCGGCGACTGTTTCGCTTGCTAAGGAGGCAGAAGATGCGTGGCAAGCATTGCAAGCAGTGG
AAAATAATCTTCAAAAGTCTACGGCAAAGGCACGACACAGACCAAAGAGAACGCAGAATGACAAGAGGACCGCTCGAGATGTCTTGAAAGGGGAAATCTC
GGAGAAGACGGACGAATTGTGGGAATCCCTTAGGCGGGAGGAAATTACAACGCTCAACAAAGCATATCCGCGGTCGAAGAAAGATGTAAAGTAACGTTAA
AACCAGATAAAGCAGAATAATAAAGCGACGACAACAAACTCTATTACGCTATTCTTACCAGTCTTCATCGTCTTCGTCTCCCAGGTCGATAATTTGAGGG
CGAGGTCGTCGGTAGCGGAGGCCACAGCTTGAGCAGCTGGCACTACTTGTCGGGTTGATCAACGTGCATCGTGAACAGCTCCACGCACCAGCAGGCTCGT
TATCTTTGCGTTCTTTATCAACGACTTGTTCACGACTTGTGCGGTAATTACTGAGAACGTCTTCCACGAAGGCATCCTCATCATCAGAATCTGAAAAATC
ACTCGTCTTTTGCTTTTTTGATGGTGACCATGAGCCCGCGTCTACCTCAGGTGCAAATGACACGCTGCGTTTCGACTTAGCGGGTACCGCAGCTGGTGGC
TCGGATTGAATCGAATCTGGGTGAGACGATTCCTCCAGAGAATTTGTCGACACTGCAGGTCGCCGAAGTGGGGGCTTTGGAGTACACGAAATATCGACTT
CAGAGGCAGTGCGAGTTTTGGACAAAAATGCGTCTTGGCCTTGGCCTTCGCCCTCTGATTCACTTTCGCCCAGGGCTTCGTCGTGTCCGTCGTCCTCATC
TGTGCTTGAACACTCAGCCTCCGATTCATCAGAGTCTTCAATAATCTTGTTTTTCTTCGATTTTGAGCGTTTGGATTGGTTTTCCTTCTCCGCACGCAGT
TTTGCAGCCTCGATAATCTCCAAACGCTTACGCTTGCGTTCCTCGTCACGCTGGTTGTCTTTTTCTTCGTTTTCAGCCTGGTGCTCCTGAAGTAACTCCC
AGTCGATACGACAACTGAAAGCAAAGCTCACTAAGTCATTCTGGACTTGCTGCAATGCTGCTTGCATCACTTCGTCGTCGACAGACGCGTAGGAGCGGTG
ATGGCCCCAACTATTCAAATCTTCTTCTGGTGGCATGCCAATTTGCGGGTGATAGCCTTTGTCACTCTCTTTATCAACGCCGTCATCACTTGAGGTGTCT
CTGTCAGGTGACGTTTCGTTTCCTGTTTCTTTTCCACTGTCATCATCGCTATCGATCGCAATAACGGATGAAGTGTCTTGGGCCCCACGAGAAATATCCG
CATCTCGCCATCGGCATCGATCACATTTCAGCTGATCGTGGGTGTCGGACATTGTGTCTTTCCGGAACACGAAAAGCCGCTTCAAATCTTTTGAAGACAG
CGAGTTCACCTCCTCTTTATCGTCAACAATATTTTGAAGGCCTTCTTTGGATAGCTGGCGTTGGAAGATTTTTTCTTCGAGAGTTCCCGTCGCCAAGAAA
CGGTAGACGAAACACATCTTCTTCTGCCCTTCGCGCCACACACGAGCAGCAGCTTGCTTATCTGTCGCGGGGTTCCAATCAGGATCAAAAAGCACCAACC
GGTTCGCGCCAATTAAATTCAAACCACATCCTCCAGCTTTACTTGAGAGCAAGAATGCAAAAGAGTTCGTTGTCGGGTCGTTAAAGGTGTCGACAAGCTT
CTTTCGCTTCTTAGCAGAAGTCGTCCCATCAAGACGCACAAATGGCAAATGTCGTTCATGACATAAAGTCGACACGACATCCAAAGTCTGCGTGTAATTC
GATACGATCACGATCCGGTCCGTTGTTGTCTTCCTCATTGAAGCCATCAAACGGTCAAGTAGAAGCATTTTTCCTGACCACTCAGGGTAGCAAGTTCGAC
TACCGAAGCCGCCTCGTCGATTGCCACCCCCGCCATTACCGGATTCCTTTGCCGCTGTAAAATACTGCGCACAATTGCCAAACCCCGGTAGCTTAGTGTT
AGTTTTTCCCATCTCATCGAAAATCAGGAGCGGGTGGTTGCACAACTTTTTCAGCGCAGTAATAGATGACAAGACGTTCGAGCTCGAACGCTTCATCATA
TCACGGCAGGCGCTGGACGACAGGAAATGATTATAAAGCTGATCCTGAAGCGGTGACAACGGACAGCAGATCACCTGCATCAGCTTTGGTGGTAGATGCT
TCGCGTTCAAAATGTTGCCTCGGCGCAAAATGAACTGATTCACGATTTCACAGAGCATTGCTGAGCACGATTGAGCTACTTGACGTTCACGATCAGTCGA
GTCAGGTTCTCGTCCAACCAAGATAGGCCCCAGGTAATTCTTCCGAAATTCACTTGGTGTGCCAAGAATGTTGGGGTTGGTAAAGTCCACCATCGCGAAA
AACTCCTCCAGGTCGTTTTGCATTGGTGTACCAGAAAGAAGCACGCGCTTTCGACACACAAGTGATGACAGAGCCTTGTTGATTTGCGAGTTGGCGTTCT
TCAGACGATGGGCTTCGTCACAAATAAGCAATTCACAGCACTCTGGCGCGTCAGCAAACTTCTGGGCATGCATACGAAACGTCTCGTACGAAATGATGAG
GACCTGGGCAGAGAATCCCGGACGCGGTCTCTTGCTTCCATCGATAAACTGGTTAATGCCTTTGATCACTGTCTCACGCTTCGCCTCAAACAGTGCCACC
GTCTTCACGCGTCCGTGCAACCACTTGATAATTTCATCGTCCCAGTTCTTCACAAGCGATGTCGGACACACCACAATTGCTCGTTTCACCGTCGGCTTCA
GGTCCATGCCCGTCATGAGCAGTGTGTACATCAACGTGATACTCTGCAGGGTCTTACCAAGACCCATATCATCAGCCAGAATGCATCCTTGACCATCGAA
TCCCCTCACTTGGCAGACACAATCGAACATGAACTGCACGCCTTCACGTTGATGAGGTCGCAGGAATTTTCCAACGATTTCAGGCACCACCACTTTAAGC
TCGGTATCTGTTTCGCTCTGCCATAGCACAAGCGGCGGCGGCGCATCGGCCGCAGGAGCTGCAACAGGAGCTAGTTCTTCTGTAACTGCAAGTTCTGGCT
CATGGAGCACCTCGATCTCCTCTACGTCCACTTCAACGGGCGGAAGGTCGTGATGCACCATAGGCTTCAACACTAACGATCCCCAGCGCCGTCTCATACC
AAGCGTCTTGGTCTGCAACAGGCGGTTGCTCTCCTGAGTGCGACCTCCTTCTCCACACGGAGACTTGAATGGACGTCGTACTTGCTGTGCGCGGCGCTCA
GGCTCCATGACCAAGAAAGACAAGAACGGGAGCCGCTTCACAGACAGCGACGCGCCGCTACGTAGTGCCTGACGATTGTTGACTGCATCCTGATCTTCAT
ACACCTCGTCGTCTTCGTGTTGGGGCTGAGAAGGCGCCGCCTTGTCCTTCACGGGGAGCACAAACGGCTTGAACTGCGCGCCACCGCCAGGACGTCGGCG
CAACATGGACGAGTTCAAAACTGCCGGAAGAGGCAGCAATGCAATTCTGATTGGACAAAAATAACAAAGTGACCATCACTCAGATGTCTAAATTGTACGC
CCGTTTGATTGGATATAAAGAAATGTGCTTTAGCACCAATTACAGCAAAGACGCAGAGACGATGGCTGGGGCGCAGATGATGGCTCTCCAGCGTGCGCTG
CAGCATCGAATACAAGGGTCTAAGCGCGTTGTTACGGCTGCCTCGGGTAGAAGAGATGCTGCTTTTGTTATTCCCGTCCTCCACGCTCGCCAGTTCGCTG
TGTTGGCGTCGAATACTGACCAAAACTCTCGCCAGACCCCATTGCAACGACTTACCGATGCTTCCCAGCGATCGTGGAAGCTCCGAGCTATAGCGAAGGA
TGTGGACAAGTCACTACCAATGGGCAGAGGAAAGAGGTTTTACAACCGTCGAGTGGTGGAGGCTGTGGAGGATAGCGACCTCAATCGAGCTTGGGCAATT
GTGGAGACGCTACATCGACGAAATCCGGACAAAACGGTGCTGTGGCCGCACACTTATAACCTGCTCCTACGTCACTACTGCAAGCAGCAGAAGACGATAA
CGAATGCAAATCTAATGCGCGTTCTGGCGCTTTTGGATTTTATGGCGGATCAAGGGTGCGCGGACCAGACGAGCTTCCAGGTCGCCATGGCTGCATGCAG
TAGGGCACGACATCTGCCCAGTGCGCGGCATGTACTGGAGAAAATGGAGGCAGTTGGACAGCAACCGGATGCTAGGATCTATGGGTTTCTGATCAACTGT
TGCGCGAGGAAACAAGGGAAGGTGGCGATGGCGGATGAGTATTTTGATGAGATGCTGTGTGCTGGCGTGAAGCCGACTGTGTTGGTGGTTAATGCGATGC
TGAGAGTGTATTCGCGAGACAGCGGGCGGTCGAAGCTGATGCTAGATCTTGTCAATCGCGCGCGTGAGGAAAACGGATTGGTTCCTGATACTGTCACCAC
TCGAACAATGGTGTATTATCTGCTTTGTGAGAACGATGTAGACACAGCAGTGGGGTATTTGCGAGGTGTTGTGAGTGATTTTCCTCTTGGTGACACGATA
AAGTTGCCCGTGAAGCGTCAAGTGGTGAATTCGTTGATTGATGCTTGTCGTCAGCGAGGAGATTGGAATTCCGCTGAATATGTGCGTACGCTTGTGAAAA
GGTCTGAAGAAGAAAACAGTTTTACTGCGGATGGAAAAAAATCTGTAAGAGACACTGCAGAACTGGGGCAGTTGGTTATGCAGCGTGATGCTTCTTCTCC
TGCGGTAGCCTGGACATTGAATGAACAAGGTTTGTCTCGGATGTCGCGATCAGATCAAGAAGCTTTCTTTCGACGTCGAAGCAAAGAAGAAAGCGTCAAA
CGCGTCATAGAGCGAATGGACCGAGGTACTCCAGTATCCAAAGCTGATCAATCTATTCAAAAGTTGTCTCTGAAGCTGGAGGGGAAACTGCGTGTTCTGG
ACGAAATGATTCGAACCGAGAGCGCGACCGCAAGTGAATTCAACGCCGTTTTAAGCGCTTGTGGGCGACAGGGTCGGCTGGTTGACGCTGTGGCCGTCCT
TGACAAAATGAAAAAGTACGCGGAAACGATAGTTGAGTGTGCACCGACGACGCGGAGTTATAACGCGTTGCTGAATGCGTGTGCGGTCCGAGGTGATATT
CATCAAGTTGAGTCAATTGTAAACGAGATGGTCGACAATGACTTACTTCTTGACCAAGTGACCATGAACACAGTGCTCAAGGCGCACCTTACGAACTTAA
AGGATGGCTTAAGTGGAAGCTCACAGGCACGCCTCACTACTGTGATGCAAGCGCTTTCATTTTATGAATGGTGTACGGAAAACCAAAAGCTCGATACCGG
GGCGGCGACGTATTATTCACTATTTCGATTGTTTGTCACTTACTTAGAGGCCCCTGATGGTTTCAGTTCCACTCCGGTTGAAGATGACAGTGGAATGAAT
TCCAATGACAAAGATGAACAGTATACTGAAGGTCAAGAAGGCGAACTGATGGCATGGATGACAGAGTTTATTACTACCGCCTGTCGTGATGCTCCTTTCG
GGTCGCTGGACATTGGAGTGTTCAACAACGCGTTTGACTTCTATTACCGGCTTGGCGACGTAGATGGATCGTTTGCACTATTTAATTTGATGAAGAAGCG
CGGTATCCAGCCAGACGACACGACTCTCGGATTGATGTTTGCAACTTGCGCGAGCCAGCAACAGTTTGAAGTGGGCTTAAATTTCTTAGACCATTTAATG
ACTGCTGAGGGCTACATGCCTACGTTGAAGGTGCTTAGTGGAGCGATTCAACTGTGCGCAAATTCGAAGAACCCGGATGGAGCGTTGGAGCTTTTCCGAG
CAATCGAGAAGTCAGGCACGTATACACCAACGGTAGAAACTTATGAGCCCGTGGTGTTTGCATATGGACGCGTTGGAAACGTATCTAGTGCGTGGGAAAT
CGCAAATGAGATGGAGGAAAAGCTTGGGAGAGTTTCTGTCAGTATCTACAATCGCATTTTGCTGGCGTGCGTTGAAGCAGCTCTCCCTGGTCGCGCTCTA
CAAGTTTTGGGAGAGATCCGCCATAAAGAAGGTGTGACGGCCGATGTCATTTCGTACAACACGGCATTGGAGGCTTTCGTTAGAGCTGGAGAGCGAGCTG
CATGGTGGAGGAAGAACAACGTCAACTGGAATGAAGACGATGATTTTGCTGGTGATACTGAAGATGGACGTGAAGAGGAATATCTTGATGATGATCTGAA
GGAGGACATGACTAATGTCGACGACTTGAATGGCCTTGAAAAGGTTCCCGAGAAGGAAACGCAGGATCTCGAGCTTGAGCACCGCGAGAAGGCTGCGTGG
GCTCGTGCCAGCATTATCGATATACTCGAAGAAATGCAGCGTAGCCGCGTAAAACCTGATATGACAACGTACGAGCGGGCAATTGCTACATGTAGCGTGA
ATGAGGACTCGGAAGGCGTTATCACCATATTCGACAAACTGATTAACCGCAAACGTGGTAATCAAGCGGTTGCTCTGAAAAGTGATCTCGTCAGTGAGTC
CAGTTTTACAGCATATCTCGTGGCATGCACTGCATTACAAGACAAGGACAGAGTCGTTGAAGCCCCGACACTTCTCAATAAGTGGCACACCGCAACGGGC
CAAATTCCGCCAGCATTTGTCGTAATGCAGTTGTTGGGCTCGCTAGAGGAGCTGGGCGAGTGGCATTGTGCTGTACGGATGCTTCCGAACTGGCAAGAGC
TTTTCGGCGTTCTACCCAGCGTTGACGTGTTCAACAGGGTCATGGAGATGTGCAATCGCGCAGGGGAGCACCAACTTGTCCCTCCAATATTCGCTACTAT
GCAGGATGCTGCGGCTTACCGCATCTACCCGGACGTGGAAAGTTACATTCAACGAATCTACGCCGAGGAACAACGTGAGAACTGGGTTGCAGCCACCGAT
TTGTTCGTAGAGATGCGAAAGAAATGCCCAAGCGAAGAGATTTCACACCAACAGCTCCAAAAGATTGCTTTGGGTCGATACAGGTTACGGCAAAATCAGC
ATTAGAACAAATGTAAGAATTGTATTCATCATTCACACGCACGTAGTGTTCAGATTCACATCGGATTTTCAAGAAGACTTTCCTCTTCGTCTCGAAGCTC
GGGGATCGACGAAGACAAAGACAAACCGTAGTTGGGACTGCCAGGGAAGCTGCTTGAGGTGGTGCTGCCACTGCTGTAACCTTCTCCGTTGCTGCCGCTG
CTGGACCGACTGTAGATAGACTTATCCGATGCGTAACAATGGAAGAACACAGCTCCAAATACCAGAACAAGTGCAGCGATCGCAAACACGAGGTCCCACG
ACCCCGTTGCTTGGAGAATAGCGCCGGTGACCACGTTGCCAATGATTCCCGGGATGGTTCCGAAAGTGTTGGAGACTCCCATGACATGCGCGGCGTGGTT
TGGCGCCACATCGATCATGTTGACCCAGTATCCAGCCATGGCAGCGCGACTAGTAAACAGTGTCATACACAGTAACGCGACTGCCATGGGGGCTGACTTC
GCAAGACGGAGAGAGAAGAGGAAGAAGGCGCACCCGAGGAACGAAAACGCGTTCATGGCTTGACGCACGTGCAGTTCACGATAACCACGAGTGACCAATA
GATCGCCAATTCGCCCGAACAACAGAGTACCGGTGTAGCCACACATATACGGCAGCGCAGCAGCAAAGCCTCCCTTTTTGGTGAGATCAAGGTTGAGTAC
TTGGTTGAAGTACTGCGGGATCCAACCCAGTAGAATATACCACGAGTAATTGTAGCACATGTGTGCGACGTAAATTGCCCACGCAGGCCGCGAGGTCAAC
AGGACCCGCCAGTTCATGGAATGGGTGTCTAGCTCAGCGCGCGAGCTCTGACGGCGATGAGTGTCTGGGTCGACCGTGCGGTTCCGGATGATGAAACTGC
GTTCCTCAGTGGAAATTTGAGGGTCCTCCTCAGGTCGACTCACGCCCATGAACACGTAGACCACAACCCAGATAAAGCTCAGCACTCCGAACACAATAAA
GATGCGTTGCCAACCAGCAGTTGCCATAATTGCAGGCGAAATGATCAGCGCCGAGATGGTGCCAAGATCTGAGCCACTTGCCACCAGCGATACAAGTCGA
CTTCGCTCCTGCACTGGGTACCACGCACCAGCAATTTGGTGCATGCATGGGAATAAAATACCCTCTCCCAGTCCCATTCCCGCTCTCGTGAAGAACAGAC
ACGTAAGGCACTTCGCCACGACAACCGTTGACAAGTCCTAGAACCAGAACACAAGAGCGTCAAACTACAAATATCGATCTAATCAATTGAATGGCATCAT
ACAAACAGCGTCCAGACGATAACTCCCGTCAGCAGTACGATTTTGGCTCCAACCTTGGCAGCGAAATACCCTCCCGGAATCTACAGCAGGTACCTCCTTC
AGCACAAGAGTTCATGGATTTAAAACACTTTGCAATGCACACGTACTTGAGTGCACATGTATCCGTAGAAGAAGGCAGACAGCACTTCGCCCTGCTCCTT
CTTATTGGTAACAAACGCTGGTAGCGCGATGCCCATGTTGGTGCCTGCATCAGCCAGAATCAGATTTGTGAACTCGGACACAATTTCCCTCAAAACAACG
TACGATCCGCATAGCATATCGTGGAGACGCAGAGGCACAAGAACGCAGTCACGTAACGACGCTTGCCTTGCGGAAGCTTTGCGGAGATGTCCTCGGAGCC
TGCTGAGACCACGTCGGCCTTCTTCCACGCCTCCTTGCTGGCCATGCTGCAGATGTCAAATGAGCTTGCGGAAAGAGGATCGCAGCCGTTACACTCATCA
GTGATTTCAGCCAATCACAGGAGAATGGACCACTTCAACGTGCGTCAGGTGCAGCACTTCACTCGACTCGATCCGGTCGCTCGTAAATTTGCATGGACAA
CCAATACATTGACAAACTCGCACCAGGCTTTACAAGAGAACTAACGGAAGTTGGAGGTGTCTCCTAGCGGCGACTTGGCACGGTACCGCTTCGGCGCGGC
GAGAGCGGACGTTTTGGTGGTCTTGTGAGCTGCAGACCCTGATCTGGGGACTTTCATGCTCCTATGCGGGTGGGCGACCACAGGCTTCTTCTTATGCAGA
CCAGATGATGTTGTCTTTCTGAGTTTCGTTGGAGTACCGTTGATCGCGTTCGTAGCAGGCTTGGTCTCAGGTCGATGACCCGGGCCCTTTGCAGTTGTAC
TTGGGTCGCTTGACTCGACTGCTAATACCGGGGCTGGATCCATTGTATCCTGGCTGCTACCTGATGAACTTTTAGCAGCAGACTCGGTGGTCTTGGCGGC
ATCGGTGCTGATAGTGGCGTCACTCTGGGATGGCCCAGTGGTTTCTTCAACGGGCGTGACGTCATCAATGGCGCTTGGACTGGCACTGGCGTCGCTCAAC
CTCCTTCTCTTATGACCAGCGAGAAACTCACCGCTAGACGAGTTAGCATAACTGGATAAATGCTTTGCAGCAGTCGCACCATTAACAGGAACTTTGGTGG
CTTCAAATGAAGGGAACGGACGTTCATCCTTTTTCATCGGCGTGTCACCTGTCCGTGCATTAATCTACAAGTAATAGCCAGCACACCAGTTAGTAGAGAA
TGCAACACGAGGAAGTAGTGTAAACCGCACCTTGCGCTTCTTCATGTAGGTCTCTGTAGCTTGCAGTTGCTCTGCAGATGCTTCGCTGGCTTCTCCAACA
ATCTCCTTGCCAATATTTGACATTGATACAACCATTGCGGTCGCCTTAGAAATTTGAGTTTGAAGCCCTTCATCCAGCGTCTTGCACCCGCCAATCAAGA
GTTGCCGAAGCTCTTCATGATCACCCAAAAACCGCGTCAATTGTCCTTGCCTCGTGTTCGACACCTCCACATCAGTCTTCGAGTGTTTCTCCAATAGAGA
CGACACATCTTCTGCGTGTTTTGAAGGAAGCAAAGCAGCATCGTTACTCCACGCAGTTTGTAACTGGTGGTGCGACTGAACCAGCTCTGTTTGCCGCGAT
GCGGCCTCACCGAACAAGCCTTGTAATTCTGACAAACGCTCGCGAAGACCAGCGGTCTCAGTTTCATGCTGGGAATTATGGCTGCTCACTGCCTGCACGA
AACCCTTCACTTCTTGTTCCGTGATAGTCTGCACGTATGAGAGCTGCTTGTGTTGCTTCTTGGAGTTTTCTTCAATCATCAGAGTCTGCTCATCTAGCTT
CTTGGATTGGCGTTCAATACAATTCTCGATGTACTGAGTTAGTTGGGTCTTCATGCCATTGAGTTCTTCTTGTTGCTGGGAATGGCTGTCCTTTAGCGCA
GTCATGAGTGCGCCTTTACCTTCGTCAAGCTCCTTAGCTTGCTTCTCGATTGACATGTCAATTGCGACCTGCAACTCAAGCAACTTATCGCTGTGCTCAT
TGAGGAAGCGGCTCAACTCCTCCCGAGATCCCTCCAGCGTCGACTGCACGCTTGCCAGGAACGACACATTTCGAGACTTGGACGAAGCCAAATCTTCCAT
AATCTCCTTAGCGTGACTCTTTGACATTTCAACCAATTTTCCGATCTGTTGCAGCATAATTTCCTGCTGTTTCGTCATCGCTGTTATCACTTCTTCACGT
TGTGTGCACTTTTGAGTGACGTCTTCAGAAATTGCCTCGACAGCCTGATCTTTGCGCGCTTCGACAAGACCTTGCAGTGCGATCAGACTCGTGATCAAAC
CATCCAAGTCAGTTGAGTGCGACGTTTCCAATTCGTGCAGTGCGCTTGACACGTCCTGAAACATGCCTTCCTGGCTCTCTTTGTGTTTTGCCAGACGCTC
TAGAAATGCGTTGATATGCGACTGCGAGTCGCTATGATACGAAGTCGCCAGCGCTGTGTTTGTTTCTTCAGTTCGCTGGGTGTTCTCTATACACAAGAAA
AATGAAGCGTAAGATGAAGCTTTTAAGAAATAAAACCATTGCGTCTTGCGTACCGATCTTCGACAATAGCTGTGCTGCCCGCTTTTCACTGTCATCATAC
AGCTTCGCAGCAGTTGCTCCATTTACCAGTAGCTTCTGTTCATTCTCCTGATAGGCATTAAGAACTCCTTGTACTTGTTGGAGTTTCCTCGTAACAGTTT
CCAGTGTTTCCTTCATGGACGTGAGTTCGCCTTCCGTAGCAGCTAATTTGCTGCTCACTTCCTGCTTCTCGAGGGTTAGAGCTGCTACCTCGCTCGCATG
TTTTTCGGCAACTTCCTCGAGCTCTTTACAAGAAGAGTCCCTTGCCTTCAGCGTTTCTTCCAGCTCCGTTAGTTGTGCACCTTGTCCGGCCAATCGTTCT
TGCATGTCAGTGAACTGCTCCAGCGGGAGATATACGCCATCTTTCAGCCTCGCAGATCTCAAGGCTGCGCGAAGTGTCTCAATTTCGCTTCCGAAATCGT
TCAAAAGCCCTGCTTTAGTCATTTTCTGGTTCAGCTCAGGCTTGTTCTTGATGCTTTTAGCGCGGAATGCATACTCAAGCGTGCTGAGCGTCTCGTCAAG
GCTGTCAGCACAGGGAGCTAGAGTTGCAATGATGGTGGTCTTGGCTCGACCTCCTAGTGACTCCTGCAGCAGACGCGTAAGCTTACTATCTCGGTACGGA
ACGTGCGGGAGATTATCCACGAGTGCCGTAATAACCCGTCCCAAGGTCAGCAAACTCTGGTTAATGGTGCCTGCCTCTCGTGCTCTGACATTGCGTGCTC
CCGAACGACCCACGCACTCTGAGCCTGCCAGATCCACAAGGTTCAACTGACCAACACGCAGCAAATCTTCACCCGCGGCGTTGTGCTCCTTGCTGTGAAT
TCTAATCGTAAAAATGCTGTGTGAACGACTGGAGTTCTCGTTCATCAACGTCTCGGACGTGATACGGTTCTTGACGCCAGTATTCACGAGCTCGTACACA
TGCTTAGCTGTAGTTGCCGTGACTTCCAACAAGTTCATGCAGTAGATGCCTCCTCTCTTGGTATCCTCCATAAGTCTCAGCTTCTTGTCTGTATCCGGAT
CCAATAAATCTTTGAGTTCTTCATTGTAGAGTTGCAGGAAGGACACACGGACACTAAACTCTTCTCCCCTGGTATCCAGAGCGTCGAAGATATAGCGTAC
ACTGCGCGGAATGATGCCAGCTGTCTCACTGCCCGGCGATAGGTCGCCCTGCATGGTGTACGTCTTGCCTGTGCCCGTCTGGCCGTAGGCAAACACTGTG
CAGTTATAACCAGCCAAAGCTTCGTCCACTGCGGGACGGACAACCGACGTAAATACATCCTTCTGCGTCGAATACTGGCCGAATACACGGTCGAACGTGT
ACGTCTTGCGCTTCACAATAGCCAATTCGTTCGCGTTGGGCTTGCACTGCACGACGGCGCCACGGCCTGCAGACTTTTCACGGCTGTTAAGGGGGCGACA
GCGTACCGCCACCTGCACATTTGTGGGCGTGGGCGACACTTCGGACTCAGAGGACGACGACATGCGGCGCTGGTCGCTGGGCTCCGTCATAGGACGAGCT
CCTTCGTCGGTTTAGATTTGAATTGTATTCAAAATGCGCGCGCGGAAAAGAGTGATGGTCATACTGAAATGGTGTTTTGCACACCACTTTGAAGTTTGGT
GTACAGAAACACCATTTCACCTGCCGACCAACCAACAGCAGCATTCAACTCACTCCATCAATCGGTCCGTCGAGTTGCAGGAAGCAGCAGGAATTTTGAT
CGACATGGCGCAGCCCAAGGTGAACGAGACGCTGCTGGACGGACAGAAGCCCTTTACCGAGTGCGAGTTTGGGCTGGACCGCCGCCTCAGCAAGGCGGTG
GCCAAGATGCGCTTCGTGCACGCCACACTCGTGCAGGTGCATTGTATTCCTTTGGCTATGCAGGGAAAGGACTTGCTGGTGCGCGCGCGTACTGGATCCG
GCAAGACTGCGGCCTTTGCGCTGCCTCTGTTGCACAAGATTCTGCAGCAAAAGCAAGACGCTCCTGCTAGTGAGCCCGCCGTGCGCGCGTTGGTGCTGGT
GCCCACTAAGGATCTGGTGGAGCAGACGCGTCGCCACATGATGGATCTCATGTACTACTGCCAGGATTCAGTGAGTCTATTGGCTCTGGGAGGACAGAGC
ATGAATGCTCAGCAGGCTTTGCTTCGTGACGCACCGGACGTGCTGGTATCCACGCCTGGTCGTCTTGTGGCACACCTTGGAGCTGGAAACCTTTCACTCA
AGGACTCGGTGCAGACTGTCGTCATTGACGAGGCCGACCTGGTGCTGTCTTTCGGATACGGCGAGGATATCCGTACTATTTTCAATGCGCTGCCCAAGGC
ATGTCAAACGTTCTGCATGTCGGCCACGCTCAGTCCTGAGTTGGAGAAGCTCAAACGCTCTGTCCTACACAACCCCGCGGTCGTGAAGCTTGAGGAGGGA
GCGACCGACGGAAAACTGCAGCAGTTCTATCTTCCAGTGAAGCCTGCGGACAAGGACCTGCTGCTCTACGCGCTGCTGCGTCTTGGCGTCGTGAGCGGAA
AGGTGATTTTCTTCGTCAACTCGACGGATACGGCCTACAGACTCAAGCTTTTCTTCGAGCAATTCGTGATCAAGAGCGCGGTGCTGAACGCCAAACTGCC
TCACAACTCGCGCCAGCACATTATCGAGGAGTTTAACCGCGGACTTTTCGACTACCTTATCGCAACGGACGATAGCATCGATCGCGATGAAGTTGGAGAC
GAGGATGAAGACGATGAGGAAGACGATGAGGAAAAGGAGGATAGTGACGAGAAATCCGACGCTGACGCAGAATCTGATGCTGGATCTGATGTGGAGAATG
ACGAGGAGAAGGACGAGAGTGACAGCGAAAAGGACGAGAGTGACAGCGAGAAGGAGGAGGAGGAGGCCAGTGACAACGAGTCTTCCGAAAATGAAGAGGG
TAATGATGAGCTGCAGGAAAAGAAGACGGTTGGTGCTAAGCGTGGACGTGCCGCTGATGAAAGCTACGGTGTCTCTCGTGGTGTTGACTTCCGCGGTGTT
CAGTTTGTTATTAACGTGGACTTCCCGAAGAGCGTACGTGCGTATACCCACCGTATCGGACGTACTGCGCGTGGTGGAGCCTCTGGAACCGCGCTGTCGC
TTGTGTCTAAGGAAGACGCCAAGGAGGAGCGTGCGCTGAAGCGTGTGCAGGCAAAGCAGCAAGCCATTCGTTCCGAGACGAATGACATCATCGCCCAGCC
TGCTGAGCTAGCCTTCGACCTCAAGGAAATCGACTGTTTCCGCTACCGTGTGGAGGATGTTCGTCGTGCTGTCACGCGTGTTGCCGTCCGCGAGGCGCAA
CTGGCTGATGTAAAGAAGGAGATGCTCAACTCGGAGCGTCTTGAGGCTCACTTCCAGGCGAACCCGCGTGATCTGAACATCCTTGAGCACGACAAGGTTG
TGGGATCTGCACCAGTGCAGGCCCATTTGGCTACTATCCCGGACTATCTCGTGCCTATCGAGCTGCAGCCACCGGCACCAGCACGCACCAAGAAGAAGCA
CAACAAGCGGCAGCGAATTGCTGACGGCAAACGTCGTACGGATAACGATCCGTTGCACACATTCGTGGCTCCTGACGGCGACGATGACAAAAAACAAACT
GTGGAGGACCGTATCAGCTACGGTAACAGTGGCGTGGGGAAGAGTACTGCTGGTCGTCAGAAATGGAAGAAGCAGCACCGCAAGGGCCACTTCAACCCCA
AGACTATTGCCAAGAAGAAGTTCAGGATGAGCAAGGGCGCCACTCATTAAGAAGTTGGAACAATTTGCAAGGTTGGGCCACATGTTCTTGCTTGTTTTGC
CAAATAGATTCACGTTTTTGCTTCATTTATGTCTTGTACGACGGCTACTGAAGGTTCCGATCCACAGTAGAAGCGAACGCCGGCATTGAAATGGGTCGAC
TGGTTCCGAAGTAACGTAGAGCTGCAGGCGGCGCGTTACTGGGTGGAACAAACATTGCGATGCTCTCTGGGTCTCCTTCAAGCTGCTGCTGGACGAGTTG
GCGCCACAGTTCATCGCCTGCAAGTTGTGCCACTCGGTCTGCAGGGAGTTCTTCATCGGCCACATCCACCTCAACTAACGCCGAATCTGCGCGTGGTTGC
AAGGCGTCGGCCATCATTCGCTTTCGGTCATACGCATAGTCTAGTAGTTGCAGACTGCGCATATGCTCAGCGTGCTCGCGTTCCACACGTGCAAGACGTC
TGTGGTCTGCCTGAGTGCTGGCTGTGGCACGCGCAGCCAGGATCTCCGGAGGTGCAGGGAAGATGGTACTTGTTGAAGCCGACAGAGCGAAAAGAGGCTT
GTTGCGACGCACCACTTCCTCACGCAGCGTCCGGAAGTCACGTGACAGGAGGAGCTCCTCTTGTGCAAGTGCCTTCATCGCACATACCTCTCGAGCTCGT
TGTGCTCGAGCATCCTGTTCAATGGCCTGGCAGTGCGCTTTGTGAAGCTGATTCCAGTGGCGGGTCTGGTCGGTTCGAGCAATTTGCATGTCAAGTCCGT
TCTCTCGGTGATCATGCACTTCCTCATTGTGGACGTGGCGAGAGATCATAGCTACACTGGCAGTAAATGCGCGAGCCATCTGTGCGCTTTGCTGTCTTGC
CCGTCGAGCCAATGCGCCGGCCTCCTTCTTCTGTCGATGTTGCTGTAGTTTAGTGTTTTTCAGCTTAGCTACTGCTGCCAACGTTCCAGGATCAGGCATG
TTGTGTGAACAAAACTTCGAGTGGAGAAGCGCTGGAGCAGACGCTGATGAATGAAGTGACGACATTTGCGGTGGATTGCAAGCGTACGACTCGTAGGAAA
ACGTGCTGGTGGCGTCGCTTTCATGTACGATCTGGTCAAATGGCGATAGATTCGCTTGAGACGGTGACTGGAGATCGCACTGCAGTGGTAACAGCTTCTT
GTGTTTTCCTTTTCCACTTTTCATCGCGCGTTGTTGTTTCTGCCACGTTGAAAGATCACGAACGTGCTCGATAAGGAACGTCTCGGTAAACCATAGACGA
CAACCTTGAATGAAATCGCTGACTGAGACTGTCGGTCCTGTCATTGTCGTTTGCTCATGTGAAATACTGGGCGGTAGACGTTGTTCCCATCGACGAAACG
CAGCATCATCTACCTCCAGTCCATGAAAGCGCAGTAACGGCTTAATCTGCTGGATCTTGATACGTCGAGTCTGCTGTACTTGCGGGTCGAAGGTAACTAT
GAGCTTTTCGCACGCAGCCATGAACGCTAAGTGACGTTTTCCACTGCTTTGTGGATCTTCTGGTGATAATTCCAAAGGGGAAGGTGACAATGGTGACGGT
CTTGATGCGGGGCTCTCATATGCGAGTGGACGACGATCAAGCTGCTTTGCGTACGGCTGCGGGCGTTGTAGCATGCGCTTCACGAGTTCGCGATCGCGTA
CAATCGCTCCTAAAGTTTTAATCGCTGCGGTTGAGTGAGGCTGGACGAGTGGCACAGTCTGGCGGTACAACTCTAGCATTTTGTCGTCATCCCTGCGAGA
TCTACCAGAGGAGTCGAAGCTGCTGTCATCGTCACTTTCTGTGGGATCATCGCCGTTCTCGGGCCGCGACAATTGGAATGCCAGAAGACATTCTACGGAA
GGAGGCCTCGTCTTCATAATGTACTTCTCCGTTTGCGGTGTCAATATTCTGCTTGAAAATAGATACTCAATGGTGATTGGTTGATTTTGTTGAAGTGGAG
CTACATGGATACCGGTAAGTATGATTCTCGCCGATCGGGTGGGCAATGCCCACTGGGCATGCTCAAATTAGCGGGTGCAGTATAGTGGGGTCACTTAGCA
TACTGTGGCGGATTCCGTAGCACAAATACAGGACGAGGCCTGCGCTCAGCCAGATAAACACGCCAAACCTAAAGAACAGTTACCACGTTAGACTCAAAGG
ATCAAATCGCTGTCCGTTTCAGTAAATTGCACGTACCATCCCTCACCAGGGATACTTGACATCATGTATACATTGGCAAGAATACCCATACAGGGCACCA
AAGGCACCAGCGGGCATTGGAACGAAGTTGTCATCTCACTACGCAAACGAAAATTAAAATAATGTTAGTAAAGTTATTAATATTAATAATTGAAAGTTGA
AAAAAAAACAAGCATGGTGCGTACCCGAGTGTCCCCAATCGGTAGATAAACACAAATGTTGCAATCACCATCATAGCGAACGCGCCTTGAATCACCCACG
GAAGATCAAACACGAAAGACAGCGACAGAGCGAAGCATGCGATCACGAAGAGGAGAACGCGCTGCACGACACCAGCTCCACTGAGACTCGGGCGCATCCG
CAGTAGAAGCACTCCAGCATTTACAAAGGTGAAGACTTGTAGCGTTCCGCACGATATCACATTGGCCAGGAAGTCGAGCTCGAAGACAAGCGCTATGGTC
GCCACAAGAATTCCCGTAAAAATAGTACTAGCAATGGGCACATGGGTCCGGTGGTGCAGCTTGGCGAAAAGTGACGGCAACAATCCATCTTTTGCCATCT
GATAGAAGATACGGGGCTGACCCATAAGGCAGGTAAACGCTGCAGTGGTAAGTCCGAAAATGGAGCCGAAAGACACGATGCGTCCAGCCCACGGTGCGTC
ATGAAAAGAAAAAGCATTCACCAACGGAACTTCGCTTCCGAGCACATCGACAGGTGCCATTCCAGTCACGACTAGCGAAACGCCAACATAAATGGTCATA
GAAATCAGGAGTGATCCAATAATTCCCTTTGGCAACGTCCGCTGTGGCTCGTGCACTTCCTCGGCTAAACAAGCCACCATATCAAAGCCCAAGTACGAGA
AAAAGACCACCCCGGCTCCTGTCATAACACCGTGTATCCCAGCAGGCATGAAGGGCTCCCAGTATGAAGTTTCCACTTCCGTACTTCCATACGCCACCAC
GAAGAGCAACACCGAGATGTTCAGTAGCGTCACAAGCGCATTGAACTTGGCAGATTCCTGCAAATTAGCCCAATAAGCACGAAATTTAAATATATCATCT
ACTGGCTACGTATCAATTTGAAGACAAAACGTACGTGGACGCCAGCGAGAAGGATGCAAGTACAGCAAATGATGAGAAATACGGCCAGGATACTGCATGA
CATGCCAAGAAACTCTACTTGAACCAGCCAATGCGGAAGATGAAGACCAAAGTGTTGCAGGAACAAGTTCGCATAGGAAGCCCAACTCCGCGCAATTCCA
GCTGTAGCAGCACAAAAAGCCCCACATGAGTCCAACCAAGTCAACATACTGCCAGCATCTAGAACACCCTTATTTACCTGCCGAGATGCCGTATCCCAGC
GTCAGATTCCACCCAATAAGCCACGCCGCCAACTCGCCGAAGGTGATGTAAACGAACGTGTACGCCGAGCCCGTAACCTTCATCCATACACATTTCAGAG
TCTCTCCCACCCTCTTAAATCCACTGAAAGCCGACAACGTACAGGTACGCGAGCTGCAAACTCCGAGTACGTAAGCGATGTAAAAATACAGGCAATACCG
CTAATGAGGAACGACAGGGAGATGCTCGGTCCTGCGATCTGAGCGCCCACACCGACGAGCGAGTAGACGCCGGCGCCTACAGAGCAACCAACACCATAAG
CCACAAGATCCAGCAGCGTCAGACACTGCTTCAACGAGGTAGGCCCGAGCTCGCAGCGCGACAAAGGCTTCACACGGCCTGCAGCCTCCAGAAATCGGTC
CATGGCGAGGGCGACAATGGGCGACGGGCAGTTACGCTGGACTTGTCTTCTCCGCAGCTGCACAGCGTGCCCCTTGCTGCGCAAACTGAGTCAGATGCAA
CACGGTAAATATTTTCAGCCAATAGAATACATTACTCAATATGATTGGATGAAATATTCCCGTATCCAAAAGGGGGCGAACACTACACAAAGAAGGCGAA
CAGGCTTGGAAGATGTCGGCCGTTCCGGAAGATGAGCGCACTCAGGTGCTGAATGCGTACAAAGCCAAGGTTATGGAGCACCGCGAGATGGAAAGCAGGT
TCGTAGCTGTCTACTGATGCAAGAATGACTCTCTAAGACGTCATAGATGCTACCCCGTAGCTCTGCGATCTTCCGGTCACTTTTTGCTTGTTGCTGACCG
TTTTACGATGATTTCACATATAATACAGGGTGAAGAACATGCGTGAGAACGTCAAGGCGCTTGTGAAGGATTTTAACAAGACGGAGGATGACCTCAAGGC
GCTGCAGGTGCGTGCAATTATACCTCCGTTACTGTTCTGTTGTCCATTTAACTGACGTTGTTTTGCTGTAGAGTGTGGGCCAAATCATCGGTGAGGTACT
TCGTCAGCTGGACGAGGATCGCTTCATCGTTAAGGCTTCCAGCGGCCCGCGTTACGTCGTGGGATGTCGCGCTAAGGTGGACAAAAGCAAGCTCAAGTCG
GGCACCCGAGTGGCGCTGGATATGACGACGCTCACCATCATGCGCTACCTGCCACGCGAGGTGGACCCGACGGTGTATCACATGCTGAAGGAGGACGCCG
GTAATGTGTCGTTCTCAAGCATCGGTGGTTTGAATGAGCAGATCCGTGAACTTCGCGAGGTTATTGAGCTGCCCCTAACCAACCCCGAGCTGTTCCTGCG
TGTCGGTATCAAGCCCCCCAAGGGTGTGCTTCTGTACGGCCCACCCGGTACGGGTAAGACGCTGCTGGCTCGTGCTCTGGCGTGCAACATCAACGCTACG
TTCTTGAAGGTGGTGGCTAGTGCGATCGTCGACAAATACATCGGTGAGAGTGCCCGTGTGATCCGTGAGATGTTCGGGTATGCCCGCGACCACCAGCCGT
GCGTCATCTTTATGGATGAGATTGATGCCATCGGTGGAAGTCGTTACTCTGAGGGCACGTCCGCTGATCGTGAAATTCAGCGTACGCTGATGGAACTGCT
GAACCAGCTTGATGGTTTCGACGCGCTTGGACAAGTTAAGATGGTCATGGCTACGAACCGACCGGATATTCTGGACCCCGCTCTGCTGCGTCCTGGTCGT
CTCGATCGTAAGATTGAGATCCCGCTTCCCAATGAAGCCTCTCGCATGGATATCCTCAAAATTCACTCGGGCCCCATCACCAAGAAGGGCGAGATCGACT
ACGAGTCGATCGTCAAGCTCACAGACGGCTTCAACGGCGCCGACATGCGCAACGTGTGTACCGAAGCAGGTATGTTCGCTATCCGCGCTGACCGCGAGTA
CGTTGTGGAAGAGGACTTCATGAAGGCCGCGCGGAAATTGGCGGAAACCAAGAAGCTTGAATCCAAGATGGACTACAGCAAGGTTTAAATTCGCGGGCAA
TGTTATCTGGCGTTGGGATGCTTTTTCTCCAGGACAAAGTTGAGAAAATGATCACAGCGCGGTGGACTACTGTATCTTGATGTTTCTTGCGTCTCCTGCT
TTCAGTTTGCATTTGCTTGGACCCTACTATTTTATCTGCGCCGCAAATAAACCGAATACGGGGGCTGACGGTAGTTTTGTATTTTGCGTCAGGTTGTTTC
GAGATGGCGTCGGTAGGTGGGGCAGGCATGGAGTGCTGTGAGCTGGTAGGTCTCATGGGCGATGTGGCATACCAACGCTGTAGAATGCTGCTTCAAGAAT
TGCGCAAGCTGCACCCAATCTTCGTGTCGCCTCTGGAAGGGATGATGGAAGTCGAATACCTGGAATATTTGCAGAGCCAACAAGATAAAATCCCTAAGAG
CAAGCGAGCAGAACTACTACGGACAACTCGGCCGATCATTCTGCTGCTGGGGTCCTTAACTGTCGTGCTGGATGGAGAAGACGAATTGCTAGATTTCGCC
ATGGAGCAGACTCAGCTATCGAAGAACGAATTGCTTGCTGCTGCTGCATTCGGAGACGTTGTAGCTGACGGCGAAGGAACTGACAGCGCCAGGAAAGAGT
ATGGTGAAAAACTGGCACTGGCTGAGGAAACGCTGGAGGCAAAGGCAGAAGAAGCAGCTCAACAGGCTCTGACACGCCATCGGGAGCTCTCAGGTCACCA
ATACGCTTTCTTGGTTTTTGAGGTTGATGGCGTAGCACTGCCCAGGGTAGAGCTGGAGCTATTCCACAACGTGTGTCCCAAGACATGCAAGAATTTCTTG
GCTTTCTGCGAGCACAAAGTCCCTGATATTAGCGACGAAGCTCAACACTTGGGCTACCGAGGCAACACTGTGCACCGTGTTGTGCGTGGTGGCTGGATTC
AAGCTGGTGATGTAGCAGGCGATGGACGTGGAGACGGACCTTGTCGATCACTGTACGGCCTTGAGTTTCCCGACGAAAGCTTCGCCATTTCACACGACGC
AGCCGGCATTCTTGTACGTGGAAACTCTTCTAATTGTGTTGCCATCTCTTACAAACATTTTGCTGCAGTCCACGGCAAACACAGGGCCTCACACAAATGG
CTCGCAATTCTTTATCACTCTTGCGCCGCAACCGTGGCTTGATCGTCACAAAGGTAAGGCAGACCGAGAACCCCACTCCAATGTACTTGTAGACCAACCT
CATCACACGCTTTTTTGCTGGACCCCAGTTGCCTTTGGTCGAGTGGTGAGTGGGTGGCGCACCATCATGACTATCGGGGGCCTTGAAACTCGTCAAGAGC
GACCTTGCGTGCCCTGCACTATCGTCGATAGTGGAAGGCTTCAGTGA