Description :
From Genome Similarity Track
Location :
contig_8:495714- 497215
Transcript NameFunction/comments
g2030.t1XP_009525140.1 hypothetical protein PHYSODRAFT_330222 [Phytophthora sojae

Sequence
1501 bases(100 bases per row)
AACTCACGTTCAGTTTTGCTTCAAGCTCTAAATGTCCTCCCTGGGCCGCCCTAGGCACCCACAGTACGACTGAACCGCCTCCTGTGCCAGGAAGACCCAA
AAAGCCCGGACGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCACTTTGGTAGTCGACGTCCACGTTGCGCTTCCACCTGCAGCCACATCGACTTCG
TCGATCTTGTCACCACCAGACATGATGTTCACTTTGACGTCTTTTGTGTCCGTACTCGTGAAATTAATAATAACCGCACCGTCGCCCTTCCTGGTCCACG
AGCTCGTGCTTCCTTTGAAAGCGCCTTTGATGGTGTGCAAGCCCAGGGTGGCTGGTTCCGCTCCGTCATCGATCTCACCCATGAATTGTGTGGGCCCGCA
GACAGTCTGCACGTACGCGATAAGCAGAGTCGATATATCCAGGTCGTCAAACCCACTCGCAGAGAGAATAATCAGCCCCTTTTGAAGAGCTTGGTACGCG
GCATACTTAGCTTTCAACGTCGTGCCGTTATTGCTCTCCCCCGAGTTGATGAGGTCGTTGATGATGACCCCGAAAGTCTTGCGAAGAGTCTCGCGCGTCT
TGTAGGCGGTCGCTTCGCTGGATTCAGATATCATTTGGCTCATGCAATTGTTTGTTACCGTGGGGACGTCTTGTAGCACGAGGTCGGACTCGCTGATTTT
GAGGCGGATCTCAGCGTCGGTGACGTCAGGGTTCTTCTCCCGGTACTCATTCACGGTGAACCACGTGCGATCCACCAGCGACTTTAAGTCGGCACCGCAA
GTCGAGTTGGACTTCATGCCCGTCACGAGTGACGAAATCTCCGTCGAGTTCAGCTCATTGGCAGCCTCCGTGAAGTTGGCCCCCGTGAGGAAGGCCTTGA
ACTTCTTCCAACTGGAGATGATAGTCGCGTTGTTGGATAGAACTTGGCTCAGGATGTACTGGGTAGTCGCCAATAAATACTTGCTGTTAAAAAGAGTTCG
CGGGACGGTCTTCCCCAAGCAGTTGATGATAGCGATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGCAGCTGGGCTTCCGTGGTC
TGCGGATCGGACGTCTTGATGTTGCGTATGTATCTGACGAGTCCTCTCACCACGGTCATCATCGAGTTGGCGCACTTGACAGCTCTCTTCGCGTACTTGC
CTACCTTCTCAATCTTACCGAAGATGCCCATGGAGGCAGTATCTAACGCTGTCACCGCAATAACACTGATTTTGTTGAACACTTGCAGCTTGCAGTCGTC
GTTTTGTCGGATGCATTCCATGCCGCACTCGACCGGGTAGTTGATAGGGCACTCCGTCCAGCAAGTGTTGGTCGCGTCGTTGCGGTCGTAGTTGCTCGGG
CACTTGTCCATGATATGTGCTTCTCGGTAGCACGCAGGGTCCGGAGAAATGCTCCACGGGCCCACCCAGTTTCGGTACGTCGAGGTGACTGTGCTGATCG
C