Description :
From Genome Similarity Track
Location :
contig_8:495706- 497207
Transcript NameFunction/comments
g1893.t1ETK76385.1 hypothetical protein L915_17197 [Phytophthora parasitica

Sequence
1501 bases(100 bases per row)
AACTCACGTTCAGTTTTGCTTCAAGCTCTAAATGTCCTCCCTGGGCCGCCCTAGGCACCCACAGTACGACTGAACCGCCTCCTGTGCCAGGAAGACCCAA
AAAGCCCGGGCGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCACTTTGGTAGTCGACGTCCAAGTTGCACTTCCACCTGCAGCCACATCGACTTCG
TCGATCTTGTCACCACCAGACATGATGTTCACTTTGACGTCTTTTGTGTCCGTACTCGTGAAATTAATAATAACCGCACCGTCGCCCTTCCTGGTCCACG
AGCTCGTGCTTCCTTTGAAAGCGCCTTTGATGGTGTGCAAGCCCAGGGTGGCTGGTTCCGCTCCGTCATCGATCTCGCCCATGAATTGTGTGGGCCCGCA
GACAGTCTGCACGTACGCGATAAGCAGAGTCGATATATCCAGGTCATCAAACCCACTCGCAGAGAGAATAATCAGCCCCTTTTGAAGAGCTTGGTACGCG
GCATACTTAGCTTTCAACGTCGTGCCGTTATTGCTCTCCCCCGAGTTGATGAGGTCGTTGATGATGACCCCGAAAGTCTTGCGAAGAGTCTCGCGCGTCT
TGTAGGCGGTCGCTTCGCTGGATTCAGATATCATTTGGCTCATGCAATTGTTTGTTACCGTGGGGACGTCTTGTAGCACGAGGTCGGACTCGCTGATTTT
GAGGCGGATCTCAGCGTCGGTGACGTCGGGGTTCTTCTCCCGGTACTCATTCACGGTGAACCACGTGCGATCCACCAGCGACTTTAAGTCGGCACCGCAA
GTCGAGTTGGACTTCATGCCCGTCACGAGTGACGAAATCTCCGTCGAGTTCAGCTCATTGGCAGCCTCCGTGAAGTTGGCCCCCGTGAGGAAGGCCTTGA
ACTTCTTCCAACTGGAGATGATAGTCGCGTTGTTGGATAGAACTTGGCTCAGGATGTACTGGGTAGTCGCCAATAAATACTTGCTGTTAAAAAGAGTTCG
CGGGACGGTCTTCCCCAAGCAGTTGATGATAGCGATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGCAGCTGGGCTTCCGTGGTC
TGCGGATCGGACGTCTTGATGTTGCGTATGTATCTGACGAGTCCTCTCACCACGGTCATCATCGAGTTGGCGCACTTGACAGCTCTCTTCGCGTACTTGC
CTACCTTCTCAATCTTACCGAAGATGCCCATGGAGGCAGTATCTAACGCTGTCACCGCAATAACACTGATTTTGTTGAACACTTGCAGCTTGCAGTCGTC
GTTTTGTCGGATGCATTCCATGCCGCACTCGACCGGGTAGTTGATAGGGCACTCCGTCCAGCAAGTGTTGGTCGCGTCGTTGCGGTCGTAGTTGCTCGGG
CACTTGTCCATGATATGTGCTTCTCGGTAGCACGCAGGGTCCGGAGAAATGCTCCACGGGCCCACCCAGTTTCGGTACGTCGAGGTGACTGTGCTGATCG
C