Description :
From Genome Similarity Track
Location :
Scaffold_315:4957- 8641
Transcript NameFunction/comments
Phymu_g8484hypothetical protein

Sequence
3684 bases(100 bases per row)
TTCGTGACCGTCGCGCTTGCTGGTGGTAAAAGTAGTTGTAGTTGAGCTGAGTCACAACCTCATTCACGTGTGGAGATGCACCGTGCTTTTGCATGGCTGT
CAGCATAACTACGAGGAAATGCGACTGTCGCTTGAACTCCGTCGAACTTCTAGTCATTTCAGAATGCAGGATACGGAAGCCAGGGTGTCCCAGCAATCGG
ATCTTAGACGACTTGCGTGGGCATTTCGTTTTGGTGATTGAGTCGgactcttcgtcgtcttcgctccAGCAATCAGGGAAGTACGTGTGCATGTTCCGGT
CTATCACACTGACAAACTCGTTGACTTGGCCAACAAAGCGCAAGATATGGTTGAACGTCGTTAGGATGTACTGAATCACCGTCGCATgctacaagcagca
acaagatcGTGTTAGAAGTCTGAGTCACAGCTCCTACCGAACTACCGCAATACCTTatccagcaggaagaagcggttCAGTAGGTGGTCCAGGTACTCCT
CATGTGCCTCATTCATCTTCGAAACAACACCAGCCGTACAGTTTAGCGAAGAGTTTCCATACTCGCAGTATCAATTTATTCCGTACCTCAGCTAAGCTTG
GTGAAGCTTGCATGACTTGACGATGCTTGGGCCATTCCTCGTTTGAGATCTGCCATAAAATAGTGTTAAGACGACAAGAGTTGCTTGTATGATCCCGGAC
ACGTCCCTACCTGACTCGTAAGATAGCTGAGCAGGCTTTTCGTGTAGTGAAGCATGTCCGCTAATTGGATGAGAAGTTGACGCATGTCCTCCTCGACGCT
AAAACAGAGAATTACGAGTCAAAGGTGAAGCTGGCCATGACAAGTGAGCATTTCCGTACAACGAATAACTCCGACGATGCCGAACTGTGGACTTGAACTG
CGTCAGCAAAGGAAAGAACAATGGTTAGAAAGCGATAGTACAAATCTTGTTTAAAGCTGCTACGTACCTTGACCAGAGCTGCCTCTACAGCCTTAACTTG
AATGAGGAAAACCCCAAGCTTCGAGTATTTCTGCATTATTGATGTGCTGAAAAGCACatgcagtggctgctgcgcagCGAATGTGAATTGTAGGCATTTC
ATAGTCGCAATATCGATTTTGGCACCGCTTGATGTGCTGTCCAGCAGATTGAAATCCACACGAACACACAGTTGGCCACCAAGTTGTCGCTGAGAAGATG
ACAGCGAGTTATCCTCGAAGACGCCTTGGACCGCACTCTGGTGGAAAGAGTTAACCAGATCGCTGTCAGCCCACGCAATGGGGTTTTCTTGCATGTGAGC
GACCAATCTCTCACTGAAAACGTTGAATACGTCTTGCTGTAGAGGTTAAACATCGTTCAAATGAGTCACCAGTAGCCTATAGCACGGTCTGTATTAGCCA
TCTTACCTGCTCCATCAGTACAAACATTCGAAGCGCTTTCACGTGCTCCATAAAGCTCATTTTATCTCGGAAAATGTCTGTAATCTCGCCATTTAGTTCC
CGACACTGCAATCAGTTCCAATAATCAAGCGTTAGAAATTACAAATGCGGTGATGAAACACGAGTATGTTTACCTTGCAGTCGAGGTGCCGCGTAAAACA
TTGCTCAAAAATCCGGTTAAAAGGTGTACACCCGAGCAATAGTTGCTGCGGCGCAAGCGGATCTGTGTCGGGCGCTTGTGCAGTAGTCACGGAAAAAATA
TCCTTACTTCGTCTGTATCCCATCCTCTCAAGATCTTCTGAAAGTAACGACCGCAAAGACCGGCGAGACTGCTCAGGGCTCGTCAAAGGCACTGCTGCCG
TaagctgctgatgctgcaaGAAGCGATTTTTCAGCTGTCGGCTGACCAACGCTTCGTTCATCAACTCTATCATCGGTTCGAGGAATGTCGGAACGAGTGA
GCGATTAATCTCAAACGGagccagcaacagcattcCCTCTCGAAACGTATGGCTTTGATCACGCATCGCCGTACTTATGGACGCAGGCGTTGCGAAGAAC
AACTCTCCATCTAGAGGAATCGCATCAAAGTAACCTCTTTCGAATACCGTCCGGTTAATCAAATCCAAGTACGGATTCAGGGCCCCAACAAATAGGTGTA
AAAGCACATCGGATCGTGACAAATTGCCATCGGCTCGTGCATTTCTGTCGGCCACTGCACCTTCGACGTATTCCATCTCCATCAAGCGGTACAGTGAGTC
AAGCACGCACTTGGCTTGCTCAGATCGTTTTACTTGATGCCAACTTCGGCCCGACAAACCTTGAAAACATTCAATTAAGACTCCCTTCAGCCACGAAGTC
ATCTTAAAAATGGCGTTTAAGCCTCCGTAAATTCCAAGCAAGGTAGGCTGGCGCAAATTAACCATAGACCACGGACTGGAGGTTTCTTCTTGCAAGGCTG
TAGAGGAACTGACCTGCACCTCCACGTTCCGTATTGAATTCGTCAAGCTAGCAACAACCTCCGAGAGAGAAGTGGCCAAGCCCTCCAGAGTCACACATCG
ATGTTGTTTACTTGAGTCTCGTGTTCGGCGGATGAATCCTAGCAGATCTCGAAGAATCTGCAACTCGGTTGCTGCTTGCGCAAAATTATCCAGTAAACGT
TGCAAAGACAAAGGTGACAGATGCCCGACTGCCACATTTAGGGACCTTCGAGACCGCTCACCTACCTTCGTCTCAAAGTCGATACTGAAGATCGAAGGCG
TTGGCCTTACCGGTCGGAATTCAAAGAACAACGAATCGATCCCATCTAACGCTTCAAAGACCATATTCACCACAGTTTCCTCATGGATAAGTCTACAGGG
CACAGCGTCCTCTGTGCTCTCTCCACTTTTAACCACCGCTTCACACAGCAACCACGGCCTCTCCAACATAAACGGAACGGGCGTTCTCGTTTCCAGTGCA
CACGTCGGATCATCTACAACGTCGATCTCCACGTCATCTTGCAAAGCAACTTCTGGGTAGTATTTGCACAGAATTTCATCCTGCTCCAACGCCTCCTCCG
ACAGTCCCAGTCGCTTTCTCTCCAACGCTTGTCTCCTTTCAACTAGGTCCTGACTTCCAACAAGCGCCATCACATTCTCCTCAGCTTCCTCACTCTCCAA
TGGTTCACTCAATCTCTTGGCATTTCGCTGGTGCATCTCTACACTGCGTTTGTTCTCCACTTCGCTCTCATCGCTGCTCATATCCcagtcttcatcttcg
tcactgtCCTCCCAAGCTTGATACCACTCGTCATTGGTGGATATCTGGAACAACTCGTCCACCAATTTGTCCTGcatcagcttctgctgtttcTGTCTAA
gttgctcctgctgcagcaccgtcTTCCACCTGCTGTTGGCGTCCAAATCCACTGCCACTTCCTGGtctgtcgctgtcgttggagaagtcgctagctccag
cagcagcttcagcacttggTAGTCGCAGTGCGGAGCCAGTCGCAACAGTTTCTCAGCTCGATCTTCAAGTGAATGCACGCGGAACTTAGTGGCTAGCGCT
TGGGTTTGAGCCAGCACATCCTGGGGTAAAGTGTCCACGAATCGATGCGAGTACAGCTGGCCCACGACGCGGTCAGcatgcagcaacagcgctTCATTGG
AGAGCGAAGACTtcgtctcttcttcctccttgttAGTTTCTTTGATATGCGcgtagagctgcttggcgagCGGCCGCCACTCGC