Description :
From Genome Similarity Track
Location :
contig_120:4956- 6992
Transcript NameFunction/comments
g13924.t1hypothetical protein
g13925.t1hypothetical protein

Sequence
2036 bases(100 bases per row)
CTCGCCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATTGTGCTCAAGAAGAATGGAGTTGATATTCGATTGTGCATCGACTACAAGCT
GGTAAATGCAGTTACGGCGATTATGGAGTACGCCATGCCTTTGGTCGACGACTTGTTGACCGACCTGGAAGCCTACTTATGGCTCTACTCGCTTGATGCA
GCCAGTGGCCTCTGGGCCATTATGATGACGATGCGGGCCCGCAAGGTCTCGGCCTTCGTTTGTGCGCTTGGACATTTCGAATGGCTCCGCATGCCGTTTG
GATTGAAGAATGCACCGATGATTTACCAACGAATGATCGACAATGCTCTGTGGGGTTTCGTCCAACCGAAGGGCGATTGGCTCCACTTTTCGGAGCTTAT
TCGAACGGCCGAGGCACACGCCGAGGCTGCACGGACAGGGGTGATCGACCCTTCACTGCGACCACCCGAGGACTCAACCACTCTGCCGACCAAATTCGAG
GCCGACCGAGAGTCCTCGGTCACGCTTGATGCGGTGAATCAGTTAGTGAACAGCCCTATTGCCGACATGTTCTTCGCTGGAGACCTGGATGAATCCTTGT
TGGTGCCAGTGTTCGACCGGCGATCGTTCGTCGATGATATCTGTTTTAGGTCCGAGACTTTCGACGCGTGCCTGGAGACGCTAGACCAACTGCTCCAACG
GTTCACTGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCGAAGGTGGACTTCGTATCGCACAAAGTCTCTGCAGAAGGTATTCGA
GCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCGTTCCCTGCTTCGGAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTACTACACCAGGG
CTTCGCAGTGTATGGAGCAGCTCTGTTTCAGTTGAAGGACGAAGACTTCACACCTAGTGGCAGCCTCTCGGCGGCCAAACGAAGCTTCGCGGCGCTCCAA
CAGAAGGTTGCAGAAGCACCGATCCTCCGGCACTTTGACCGAGACAAAGAGGTGCATGTCACATTAGGCATTGAGCTCCACTTTGATGCAATCCCACGAT
GACAAGTTGCACCCGGTCCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTGGCACTACTGCTGGTGT
TGAAGGTGTGCTACTCTTAGTTGATGGGTCGGACCATCCACGTTTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAGTCTAAGACACTGTTCGGTCG
AGCGACCCATTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGTCCAGCATCTACAAGCCGGTCTC
ACAAGCTTCGTTGAATTGGAAGACTCGTTGGCCCCGGTTACACCTCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCATTTGCTTTATGCTTGCC
TACCGAGTTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGATCGAAAAGAACGGCGGGTATGGCAGTTGCTCGTGGACTAGCCGAGCGCC
GCCCGCGTTGCGGGCAGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTGCTATGACAGGGTTATGTTTT
ATATCAGTATATTTTACAGTAGACTTATACCATAACCCTAAGCCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTG
GGTTTTCACACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAA
AGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTAGCCGTGTACACT
CCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAAC