Description :
From Genome Similarity Track
Location :
Scaffold_1470:4955- 7308
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1470-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1470-snap-gene-0.2Conserved gene of unknown function

Sequence
2353 bases(100 bases per row)
AGGTCGCGCCTGAAGAGATCGTCGACGTCGGGAAAGGTCTTGTTCTTGAAGTTCTCGACGGTGGCCAATATCCAGCCCCACAGAAAAGCATCGGTAAGGT
CATCATTGCTCTTCTCACACTTAATTTCTTACAGTGTTTCAAACAGTGCTTCATCAAATGAATTGCGGACGCTCACCATGACCGCGTCGAGGGCTTCGGT
GGCCGTCTTGCAGCGCAAGCGGATGGCCACCTTGTACTCCAGGCGATGGTCGAGCCATCGATCCAGCGCTTCGTGCGGCGTGTCGGCCACCTTTGGCGCA
GTCACGAAGGTGAAGATTGGCTGTGGGACCGTGGCGTGAGTGGCCGTCCGCGCACTCGCCGTAATAGTCCTGCTTTCCGGTCGAGACGCAGTTGCCGGAA
CCGCAGTCGCAGCAGCTCGTGCTCCTGAAGCACCAGCACCAGTCGTCGTCTTGCGCCGCGTTGCTTCAGCGCGCAGCCGCTGGACCGCCGCTGAGAGCAC
CTTGAGCAGACTTCCTGGGTCGCAAGGTTCGGGTTTGGGCTGTTGCAGCTCCTGGCTGGGGAGTGGCGCTTGACGCGCTTGATTAAACTCTTGACACTCT
TCCGTTGCTCATTGTCGAACCACGGGAACTAAAGCTAACTTTGTAGTTGGTCTCGACAGAGAATACACCAACTCTTGATGGGTAAGCTGACAGCTTCCTG
GTAGTCGTACTTGTATTTATCTTGCAGATTGCAGAATGAAAATATCAAAAGCTCTCACAGTCTACTTGCCCCGTCCTCCAACAAGAGGGCGTGGGTGTTG
CTTCTTCCACCTACTGCCAGCTCATCATCTGTCCTCGACAGACGGAGTCTCAGTAAGTGGCAGGGATGGGAAAAAAATAATTGAAAACATATATTTCAAT
TTCAATAATTAATTGGATTTGATTGAGCAACTATTTTTGAATTACTAACACTGGTTTCAACACCAACTGGGCAGTCCATTCGTCCAGGAGCCCGCGCTGC
CAGCGTCTCTGCTCTCCAGCTCAGCCAACCATCCTGTTATTGTGTTCTCTCAGCGGCTCAGCTCGTCTCACTCTGATTTCCATTTCCATTTCCAGACCCC
CAGCACCACCTCCCNNNNNNNNNNGTTGTAAATTTCGCCGTATACCTCTACAACATTATACTGAATCAGATTATAAGATTGTACAGTAACCCGACCCGCG
GTATCCAAGATTGTGTATATCTACATAGAAAATATGGTAATTGGATTTTATTGAGCAATTATTTTTGAATTACTAACACTGGCTACAACACCAGCTAGGC
AGTCCATTCGCCCAGCTGCCCGCGCTATCAGTGGCTCAGCTCTTCAGCTCAGCCAAACCATCCTGCTCATGAATTATCGCAGTGGCTCAACTTGTCTCAC
TCTGATTTCCACTTCCAGACCCACAGCACGCTTTACCACGTCCCCCAGCGCCTCGACACCATGTCATTCAAGCAAAGTCATCACCAAGCTCCTTACCCGC
AAGCTCGCTGCCAAGTTCTTCGAATGCAACAGCTGCGGAATGGCGATAGAGAGCGTGTAACCGGGCGTTCCCGAGTTACGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCAAGTCGTTGTCACC
GACCCCAAAGTGCTCTCTCTTCACGTCGTGGACAAGCGCACCAGCGATATTTATCGCTGGATCGACTGGACCGTAATGAACCGCGAGCCTTTGACATTCT
GCGAGAGAGAGCGTGTGAAGAAAAATACGGCTCTCTCGTCGATCTCGACGAAGACGCTCAAGACGTACATGTACCAACTCGCTCAGCGCGTGGAGTCTAC
ATTCTTGACCACCCTTCCAAGCAGTTTGGGCTGGTTCTCGACGACTGGACCAGCAGTGCGCGTCACTACATGGCGGTCTTCGCTGTGTACACCGACGCCC
GTGCTGCAGCAAGCATTAGTCCCCTCGGCTCAAGCTCTCTCCACGATGATCGCGAATGAAACGGCCGGCGCTTCGTGCTCTTCGCGTTCTGTCCAATGGA
GGACGAGGGGGACCTCAGTGCGCAAAGTCTCTTCGACTTGATCGCGGACACGCTATCTCGGTTCGGGAAGCCGTGGGAGTCCGTGGCCTTCATGGTCGGG
GAAAATTGCTCCGTGAATCAGTACATTGGCTGTCGCGAGGGTGCCATCCCGCTGATTGGCTGCGTATCGCACCGCTTCAACCTGTGCATGCGCGACTTCT
TGGAGTCCGAGAAGCCGCTGTTGGGTAAAGTTCACGCGCTTATGCGCAAGTTG