Description :
From Genome Similarity Track
Location :
scaffold_120:4955- 6992
Transcript NameFunction/comments
g6647.t1hypothetical protein
g6648.t1hypothetical protein

Sequence
2037 bases(100 bases per row)
GCTTGCTGAAAGCTCGCCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATTGTGCTCAAGAAGAATGGAGTTGATATTCGATTGTGCAT
CGACTACAAGCTGGTAAATGCAGTTACGGCGATTATGGAGTACGCCATGCCTTTGGTCGACGACTTGTTGACCGACCTGGAAGCCTACTTATGGCTCTAC
TCGCTTGATGCAGCCAGTGGCCTCTGGGCCATTATGATGACGATGCGGGCCCGCAAGGTCTCGGCCTTCGTTTGTGCGCTTGGACATTTCGAATGGCTCC
GCATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATCGACAATGCTCTGTGGGGTTTCGTCCAACCGAAGGGCGATTGGCTCCACTT
TTCGGAGCTTATTCGAACGGCCGAGGCACACGCCGAGGCTGCACGGACAGGGGTGATCGACCCTTCACTGCGACCACCCGAGGACTCAACCACTCTGCCG
ACCAAATTCGAGGCCGACCGAGAGTCCTCGGTCACGCTTGATGCGGTGAATCAGTTAGTGAACAGCCCTATTGCCGACATGTTCTTCGCTGGAGACCTGG
ATGAATCCTTGTTGGTGCCAGTGTTCGACCGGCGATCGTTCGTCGATGATATCTGTTTTAGGTCCGAGACTTTCGACGCGTGCCTGGAGACGCTAGACCA
ACTGCTCCAACGGTTCACTGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCGAAGGTGGACTTCGTATCGCACAAAGTCTCTGCA
GAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCGTTCCCTGCTTCGGAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATT
ACTACACCAGGGCTTCGCAGTGTATGGAGCAGCTCTGTTTCAGTTGAAGGACGAAGACTTCACACCTAGTGGCAGCCTCTCGGCGGCCAAACGAAGCTTC
GCGGCGCTCCAACAGAAGGTTGCAGAAGCACCGATCCTCCGGCACTTTGACCGAGACAAAGAGGTGCATGTCACATTAGGCATTGAGCTCCACTTTGATG
CAATACCATGATGACAAGTTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGC
TACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCTAAGAC
ACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCTCAGCTTCTC
CAAGCTGGCCTCACAAGCTTCGTGGAATTGGAAGACTCGTTGGCCCCGGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGC
TTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGGGTATGGCAGTTGCTCGTGGACTA
GCCGAGCGCCGCCCGCGTTGCGGGCAGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTGCTATGACAGG
GTTATGTTTTATATCAGTATATTTTACAGTAGACTTATACCATAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGC
TTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGC
TATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTAGCCGT
GTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCG