Description :
From Genome Similarity Track
Location :
Scaffold_2:495472- 499576
Transcript NameFunction/comments
Physo_252122PREDICTED: uncharacterized protein LOC101493138 isoform X3

Sequence
4104 bases(100 bases per row)
TTGAACTTGTACAGTAGCGCCCCACAGCTGAGTCGGGACAGCGGGATCCATTCGGGGTCTGCATACCCCTTCCACTTGATCAGGTATTCTCGAGTGCGCT
TGGATATCCGCGTCCTCTTGATCCATCTCAAATCCAGGATCGGCTCGACCTCGTACTCAGCATTGGCATGATCGGGTTCCCAACTGTCCTCGGGCAATAG
TGCGGCGTCGAAATCATCCTCATCCTCGAGGTCCAGCTCAGTCGTGGGCCGTTTCGGGAAGACCGCCCTCGGTTTGAGACGACTCACATGGACCCATGGG
TTAACCCGGTAGCCGGTGTCCTCGATCTTGAGGCGCACCCGAAAATCATCCCGATTTTCATCAATGCGGAACGGGCCATGCCACAGGTGTGCCAACTTTC
GACTCAATCCAGGCTGGACCTTCGGGATGTAGAGCCATACGGCGTCTCCCTTCTCGAATCCAGACTTGAGTCGCTCCGTTAGTTCGTTCCACTTCCGGGT
CTGCTCCTCTGACTGGGCGCGCTTCGCCTTCTTCTGGAGATCCTCGGCACATGCTCGGGCGTAACTGTAGTCTCGCTGGAACTTGCGTCTCCACTCGTAA
GCCGTCAGTTCAGGAAGGCTGGAGTGTCTGGGTCCCAACATTGCAGTTACCGTGCCCTGGGCATCCTAACCGTGCACCAGATAAAACGGGATGTCAAGTC
GGGTTGCGTCGAATGAGGTATTCAGGGCGAACATCAGCCTCTCAGCATGGTCGTCCCAATCTGACTGGTCTGCCTCAGCGACCTACGCCTTGACACTCCG
AATCACCGTTTGGACCGACCGCTCTTGTTGGCCGTTCGCCTGAGGTCGATAGGTCAGAGTGGCTCGTTGCTTGCTGCCCAGGATCTCCCGGAACCTGGTG
AAAACTTCGCTCATGAACCTCGGATCTTGATCGTACCGAATCATGGAGGACGCCCCGAAACTCCTGAAGACACGTTCCTCGTAGGCTTCGGCAACGTCCT
GGGCGGTGGTTGAGGACATCGGTTGACATATTACATACCCAGAGAAAGCATCCTGGAATAGTAGCAGAAACGTGTTTCCTCGCGCTGACTTGAGCATGTG
CGTCACGAAATCCATGGAGACCACCTCGAATGGGCGTCTAGGCTCAATGTTGCCTGGCGACGGTCCTGGATTGGGAGGTCTCCCTTTGCCACTGGCGTAG
TCGATACACTCTTTCACGAAACGCTCCACGTCTGCATGCATGCCTGGCCAGTAGAACTCCGAACGTAGACGCTCATGCGTCCGCGTAATACCTTGGTGTC
CACCTTGGTAGTCTTCGTGTGCATAATGAAGTAGATCTTCTTGCAGCGCTTCCGGGACGGCCAAGCGCGGCTCATCATGGGCGTCATATGGGCGATCCCG
GGTGGACCGAGCAAGTCAGTAGAGTACGCCTCTAGCGTCCAGGGCGAAAAAGTCTGCCGCCTTGGCGATCTTTCGCAACCTGTGAGGGGAGAAGTCATCT
GTCTCTCCATTCAGGAAGTCCCGAATCTCCATGAGGTAGTAGTCGTCCTGCTCCTGGTGTGCCTTGATGCGGCGCCACCGTTCTGCCTGGTATTCCAAGG
GCCCCATGGGTGGGGGCTCGTCCTGCGTGCGTCCTGCCTGAGTCCTTGTCAGCACCGCCATTACCCGGGCTCCCTCCGTGAGCGGGGCAGATTCCGGGCC
GGGGCCCGGATCCACTTCAGCAGACATTCCGGGAGTGGAGTCAGAAGGACTTCCCGAATCTGTGGGTTGTTCATCTGGGTCAGCAGTAATCGTCTTCACC
AATTGCTCTCGGATCTTGGACACCACTTCCAAGTGCTGCCGCTCCTCGTCATCCTGAATCGCGCAATCTTCGCCCACGGCCAGTATCTTGGAGGTCAAGT
AGTCCGCGGCCTGGTTGTATTCACGCTTGACGTGTACCAGTCCGACTGTCCTGAATTTCTCCTTGAGCACATGACATTCGGCGAGCCTCCGCTGCAGGGG
AGGCTGGTTGCAGTTGATGAGTCCTTGTACCTGCTGAATGACGATCCTTGAGTCACCCACGACCACCAGGTCCGCGATGTCCCGCTGGAGCGCCATGGTC
ATGCCTTTCAGTAGTCCATAGTACTCCGCGTTGACTGTCACTCCATCCAGGGTGTAGCCGCGAGCCTCGATGACAGTCCATTCGGGAAGCTGCCACAGTA
TACACCCGCAACTTCCTTGTTTCGTGGACGTCTTAGCTGCGCCATCGAAACTCAGTGCGACTCCCGAATAGTCTGGCTCCAACATCTCCACACTCACCAC
AGGCGGCGCCTTCACTCGCCCCTTGGCCGGGATCAGCGATTCGGCCACTTCATCTAGATGCTCTCTGGGCGTGATACCCGCACCCAGGATGGCGGCCAAT
CCGTCCTCGTCCCTTTGCTATTTCCGGATGTTCAGGTCGTAATGTGATAGGGCAACGCCCCAAGGCACCGTGCGACCATCCGCGGTTTTCGACTTGATCA
CCCACTTCAGGACGGAGTACCTGGTATACACAACCAGCGGGCATCCTTTGACCAGGGCCTTGAACACTTGGAGTACCCGGATGACCGCGAGCACTTCCTT
TTCGGCGATGTGATACCGGAGGTCGGCATCATTCCGGACACGCCCCGTGAAACGTACAGGTTGGATCACGCCATCATACTCCTGTCCGAGGACAGCACAT
GCCACCCACTGATTTGCATGCGGGATGATCACAAACGGCTTAGTCCGGTCCGGGTGTCTGAGCATCGGTGTGGATACAATCTTTCTTTTCAGGATGTCGA
TCGCCTCCTTCGCCCGAGTCAGATCTCGACCGTCCCGCACTTGATCGTCCGTTAACTCATACAGCACCACAGCGACCACTGGAAAGTCTTCAATGAACTT
GTGGTAATAATTCAGGCTTCCCAGAAAAGATTGGATCCCTTTCAGGGTCTTCGGGAACGGCGAGTCCTGGATACCCTTCACAATCTTTGGAGTCGCTCGA
ATCCCTTCAGCTCCGATCTCATGAGACAGGTACGGAATGGTCCGCTTCCCGAATTCACTCTTGGGCAGACTGAACGAAATGTTCCAGTACCTCAGTCGGT
ACAACAGCGCGTTCAGGTGGTCACACAATTGGTCCCAAGTGGTGGCTCCATGTGCGATGTCGTCGATGTAGGAGCTCTGCCCCAGGACCGGGCCCATTTG
GGGTGGTGCAGGTATGTTGCGCTTGAACACCGTCATCTGGTCAGTCAGGGCGGGCAGACGTCCCTCTTCCGGGGCGGCTTCGTCGTCACCGTCGTACTCA
GCTTCTGGCTGCGAAGGATCCAACCTTAAGTAATCCAGCACATCTTGATCTACCATAGCTTCCTCCTCGGGCGGCAACCGAACGAATCCCCACAAACAGT
TGTTGATCACATGTTGGTAGACGAGCGGAGCGTTTTTCAACCCGAATGGCATCCGTACCCACTGGAAATGCCCGAATGGGCACACAAATGCCGAGATGAG
CTTGGCTCTTTCCGTCATCCGAATCGCCCCAAAACCACTCGCCATGTCCAGACTCATGAACCACATCGCCTTCTCGAAACCGATTAGCAAGTCATCAATC
AGAGGCAGCGGGTAGCTGGACAGCTGAATGAAACCGTTCACGACTCTATAGTCGATGCACATCCGAATGTCGACACCGTTCTTCTTCAGGACGATCACAA
TCAGGGAAGCCCATGGCGATTCAGAGTGTTCGATCAGTCCCGTCTCCAAAAGTTTCTTCAAGAGTTCGTAAACCTTCACCATAAGATGTGGAGCCACGGT
TCGGGGCCGTTGGACCACCGGCTTCGCGTCTCCGACGTCTAGGTCGCACACCACGCCTCGGGCAGGCGCTGGAGCTGCGTTCCCGTCACCCAGGAAGATT
GTCCTGTGGTACTTCAGAATGTCCTTCAGCTTACTCTCCTGAGCAGGAGTGCTCACTCCGGGCTCATCTTGTCAATGTCGCACTCCGGGCTGATATCATG
CAATTCGGGGAGCAGGGCCAGTTGGTCCCTCAGCTATGCTACCAATTCACTTCCTTCATGAACGTACACCGCGGGATCCAGGTCCAACTCCTCAGCGCTC
ACTC