Description :
From Genome Similarity Track
Location :
Scaffold_2:495464- 499359
Transcript NameFunction/comments
Physo_252122PREDICTED: uncharacterized protein LOC101493138 isoform X3

Sequence
3895 bases(100 bases per row)
CCCCTTGGTTGAACTTGTACAGTAGCGCCCCACAGCTGAGTCGGGACAGCGGGATCCATTCGGGGTCTGCATACCCCTTCCACTTGATCAGGTATTCTCG
AGTGCGCTTGGATATCCGCGTCCTCTTGATCCATCTCAAATCCAGGATCGGCTCGACCTCGTACTCAGCATTGGCATGATCGGGTTCCCAACTGTCCTCG
GGCAATAGTGCGGCGTCGAAATCATCCTCATCCTCGAGGTCCAGCTCAGTCGTGGGCCGTTTCGGGAAGACCGCCCTCGGTTTGAGACGACTCACATGGA
CCCATGGGTTAACCCGGTAGCCGGTGTCCTCGATCTTGAGGCGCACCCGAAAATCATCCCGATTTTCATCAATGCGGAACGGGCCATGCCACAGGTGTGC
CAACTTTCGACTCAATCCAGGCTGGACCTTCGGGATGTAGAGCCATACGGCGTCTCCCTTCTCGAATCCAGACTTGAGTCGCTCCGTTAGTTCGTTCCAC
TTCCGGGTCTGCTCCTCTGACTGGGCGCGCTTCGCCTTCTTCTGGAGATCCTCGGCACATGCTCGGGCGTAACTGTAGTCTCGCTGGAACTTGCGTCTCC
ACTCGTAAGCCGTCAGTTCAGGAAGGCTGGAGTGTCTGGGTCCCAACATTGCAGTTACCGTGCCCTGGGCATCCTAACCGTGCACCAGATAAAACGGGAT
GTCAAGTCGGGTTGCGTCGAATGAGGTATTCAGGGCGAACATCAGCCTCTCAGCATGGTCGTCCCAATCTGACTGGTCTGCCTCAGCGACCTACGCCTTG
ACACTCCGAATCACCGTTTGGACCGACCGCTCTTGTTGGCCGTTCGCCTGAGGTCGATAGGTCAGAGTGGCTCGTTGCTTGCTGCCCAGGATCTCCCGGA
ACCTGGTGAAAACTTCGCTCATGAACCTCGGATCTTGATCGTACCGAATCATGGAGGACGCCCCGAAACTCCTGAAGACACGTTCCTCGTAGGCTTCGGC
AACGTCCTGGGCGGTGGTTGAGGACATCGGTTGACATATTACATACCCAGAGAAAGCATCCTGGAATAGTAGCAGAAACGTGTTTCCTCGCGCTGACTTG
AGCATGTGCGTCACGAAATCCATGGAGACCACCTCGAATGGGCGTCTAGGCTCAATGTTGCCTGGCGACGGTCCTGGATTGGGAGGTCTCCCTTTGCCAC
TGGCGTAGTCGATACACTCTTTCACGAAACGCTCCACGTCTGCATGCATGCCTGGCCAGTAGAACTCCGAACGTAGACGCTCATGCGTCCGCGTAATACC
TTGGTGTCCACCTTGGTAGTCTTCGTGTGCATAATGAAGTAGATCTTCTTGCAGCGCTTCCGGGACGGCCAAGCGCGGCTCATCATGGGCGTCATATGGG
CGATCCCGGGTGGACCGAGCAAGTCAGTAGAGTACGCCTCTAGCGTCCAGGGCGAAAAAGTCTGCCGCCTTGGCGATCTTTCGCAACCTGTGAGGGGAGA
AGTCATCTGTCTCTCCATTCAGGAAGTCCCGAATCTCCATGAGGTAGTAGTCGTCCTGCTCCTGGTGTGCCTTGATGCGGCGCCACCGTTCTGCCTGGTA
TTCCAAGGGCCCCATGGGTGGGGGCTCGTCCTGCGTGCGTCCTGCCTGAGTCCTTGTCAGCACCGCCATTACCCGGGCTCCCTCCGTGAGCGGGGCAGAT
TCCGGGCCGGGGCCCGGATCCACTTCAGCAGACATTCCGGGAGTGGAGTCAGAAGGACTTCCCGAATCTGTGGGTTGTTCATCTGGGTCAGCAGTAATCG
TCTTCACCAATTGCTCTCGGATCTTGGACACCACTTCCAAGTGCTGCCGCTCCTCGTCATCCTGAATCGCGCAATCTTCGCCCACGGCCAGTATCTTGGA
GGTCAAGTAGTCCGCGGCCTGGTTGTATTCACGCTTGACGTGTACCAGTCCGACTGTCCTGAATTTCTCCTTGAGCACATGACATTCGGCGAGCCTCCGC
TGCAGGGGAGGCTGGTTGCAGTTGATGAGTCCTTGTACCTGCTGAATGACGATCCTTGAGTCACCCACGACCACCAGGTCCGCGATGTCCCGCTGGAGCG
CCATGGTCATGCCTTTCAGTAGTCCATAGTACTCCGCGTTGACTGTCACTCCATCCAGGGTGTAGCCGCGAGCCTCGATGACAGTCCATTCGGGAAGCTG
CCACAGTATACACCCGCAACTTCCTTGTTTCGTGGACGTCTTAGCTGCGCCATCGAAACTCAGTGCGACTCCCGAATAGTCTGGCTCCAACATCTCCACA
CTCACCACAGGCGGCGCCTTCACTCGCCCCTTGGCCGGGATCAGCGATTCGGCCACTTCATCTAGATGCTCTCTGGGCGTGATACCCGCACCCAGGATGG
CGGCCAATCCGTCCTCGTCCCTTTGCTATTTCCGGATGTTCAGGTCGTAATGTGATAGGGCAACGCCCCAAGGCACCGTGCGACCATCCGCGGTTTTCGA
CTTGATCACCCACTTCAGGACGGAGTACCTGGTATACACAACCAGCGGGCATCCTTTGACCAGGGCCTTGAACACTTGGAGTACCCGGATGACCGCGAGC
ACTTCCTTTTCGGCGATGTGATACCGGAGGTCGGCATCATTCCGGACACGCCCCGTGAAACGTACAGGTTGGATCACGCCATCATACTCCTGTCCGAGGA
CAGCACATGCCACCCACTGATTTGCATGCGGGATGATCACAAACGGCTTAGTCCGGTCCGGGTGTCTGAGCATCGGTGTGGATACAATCTTTCTTTTCAG
GATGTCGATCGCCTCCTTCGCCCGAGTCAGATCTCGACCGTCCCGCACTTGATCGTCCGTTAACTCATACAGCACCACAGCGACCACTGGAAAGTCTTCA
ATGAACTTGTGGTAATAATTCAGGCTTCCCAGAAAAGATTGGATCCCTTTCAGGGTCTTCGGGAACGGCGAGTCCTGGATACCCTTCACAATCTTTGGAG
TCGCTCGAATCCCTTCAGCTCCGATCTCATGAGACAGGTACGGAATGGTCCGCTTCCCGAATTCACTCTTGGGCAGACTGAACGAAATGTTCCAGTACCT
CAGTCGGTACAACAGCGCGTTCAGGTGGTCACACAATTGGTCCCAAGTGGTGGCTCCATGTGCGATGTCGTCGATGTAGGAGCTCTGCCCCAGGACCGGG
CCCATTTGGGGTGGTGCAGGTATGTTGCGCTTGAACACCGTCATCTGGTCAGTCAGGGCGGGCAGACGTCCCTCTTCCGGGGCGGCTTCGTCGTCACCGT
CGTACTCAGCTTCTGGCTGCGAAGGATCCAACCTTAAGTAATCCAGCACATCTTGATCTACCATAGCTTCCTCCTCGGGCGGCAACCGAACGAATCCCCA
CAAACAGTTGTTGATCACATGTTGGTAGACGAGCGGAGCGTTTTTCAACCCGAATGGCATCCGTACCCACTGGAAATGCCCGAATGGGCACACAAATGCC
GAGATGAGCTTGGCTCTTTCCGTCATCCGAATCGCCCCAAAACCACTCGCCATGTCCAGACTCATGAACCACATCGCCTTCTCGAAACCGATTAGCAAGT
CATCAATCAGAGGCAGCGGGTAGCTGGACAGCTGAATGAAACCGTTCACGACTCTATAGTCGATGCACATCCGAATGTCGACACCGTTCTTCTTCAGGAC
GATCACAATCAGGGAAGCCCATGGCGATTCAGAGTGTTCGATCAGTCCCGTCTCCAAAAGTTTCTTCAAGAGTTCGTAAACCTTCACCATAAGATGTGGA
GCCACGGTTCGGGGCCGTTGGACCACCGGCTTCGCGTCTCCGACGTCTAGGTCGCACACCACGCCTCGGGCAGGCGCTGGAGCTGCGTTCCCGTC