Description :
From Genome Similarity Track
Location :
contig_141:49538- 50987
Transcript NameFunction/comments
g11667.t1hypothetical protein PHYSODRAFT_260005
g11668.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
TTCCACTCGCTCTCCAGCTGCTGCATGGCCGTCTCCGCATTCCCCACATTCCTCGCTGTCTCCTCTTGTTTCTGTCCGCTTTTCACCTCGAAAACCAACG
GCAGCAGCGTCTCGATCTCCTTCATCAAGTCTCCCAGGTCCGTGCGCTTCACCGCCAGATCGTGTCGCAGCTGACGCACCCTGTGAACGTCGATATCCGC
GCGCGGGAAGCCCTCACTGTCCACCAGCGGTCCGCGCAGCCCCGGGTTGTTCCCAGACGTCAACTCGGCAGCCAGCGCCTCCATCTCCGCCTCCAACGTG
TGCTTGGCCGCCTCAGCGCGCGCGTATCGATCCAAAACGTCCATTTTGGGAAATGAGCGCTTCTCATTCGCTTAAAGTTAGTTTCCACCAATCACATGAC
CTTCTTCGCCTGCTACCTGCTGACGCCCGTGCAGGCGCCGCAGCGACTCCGCTGCACGTACGTGGGCTTCACGGTCGCTCCTGCAAGGCGCATCCGGCAG
CATAACGGCGAGCTGGCGGCGGGGGCCAAGCGTACACGCAAGAACCGACCATGGTAGGTGAATACGTATTTAATATTATATTCATATTAAAAATACTAGT
CACAATGTATTAAATCTCATGTGAAATGCTATAGGGAAATGGTGGCCGTAGTGCACGGATTCCCCAGCAAGTTCCGCGCGCTGCAGTTCGAGTGGGTCTG
GCAGCCCATCGGTGAGTAAACTCACTAGGAACCATCTTGAGTTCCTGCGAGGCTCGAGAGGACTGGGGGCTCCACGGTCGGTCAAGAGGAAGGTGGTGGA
GATGCTGGAGATGGTCAACCTGGACCCATGGAAGACGCTGAACCTCACCGTGAGCTTCACGACGGACGAGGTGCACGACATTGCGAGGACGCTGGGGGCA
GATACAGCGCTGCAAAGTGCGACACGAGAGCGTTGATCACTTTTGCTGACGTCACTTCAACTTGCAATTGTTTCGTTTGTGAGTCCACAGTAGAGGACAG
TTTGGATGACGCGGTGGGGTGTTATCATGACGGGTGCGACATGTGCTGCCATCCCGAGTGTTTGGTGGACCATTTTCGGTCCATGAGAGACTCGGAGGAG
GACGAAGAGACGAGTGGAGAGTGTCCGCAATGTCAGCAGGTTCTTAAGTGCCGTTTGCTGACGAAATATCATGGGGAGAAGAAGAATCGGAAGAGACGAC
GTGGTGGACGCAGAAAAGGCGAGAAAAGAGTGCGCGTGGCAACTGCACAAGGGACGAATGATGAAGAAACACACCCTCTGCGTGTTGTGGAGCAAGGCCC
AACTCCAGATGATAGTAGGCAAAAAAGATGCGACGGAGAGGGAGTGGATGCGATTATCATCGGGTCGCCGCCTTCTTCAGGAAGTTTTGCGGCTGAGTAC
AATTCGGATGGCTGGTTTGAAGACGATGGGATTTACGCTAACGATGGTG