Description :
From Genome Similarity Track
Location :
scaffold_86:49526- 50546
Transcript NameFunction/comments
g6798.t1 hypothetical protein PHYSODRAFT_297590

Sequence
1020 bases(100 bases per row)
CTACGCAATGCAGCTCAAACACTCGTTTCCGAGGCAGAACTCGGACAGCAGGACTGCATGGTCGGAGCTGGAGTACCCGCCGAACGTGTCAACAAGAATC
GTGCCGTTGCGCAGACAGGTGTTGCTGTCACGACGCGAGAAAATGTAGTCGTACTTGGCGCCCGCTGGGTTGTTCCCGAAAGAAGAACCAATCCACGTGG
GTCCGCCTGCACCAGCAGCCGTTAGCGTGTCGTACATCGGGATCGGTGTGTTCGCTCCATCGATCGGGCCCTGGTTAGCGAGATACAGGACAGCAGAACT
CTCAGGAACAGCGTTCAGGTCTCCGGTCATGAGCACGGTGTCTTCCGGCTGGCAGTGCTGGCTCAATCGTTTTGCGACCAGAAGAGATGACTGGGGTTGG
CCGAGCGTTATGTCGAAGTGTGTGTTGAGCATGCACACAACGTGGTTGGTGGTCTTTTCACGAAAGCGAGCGATGACGGCCGCGCGGAGATACTGAAGGC
CCCACGTGTTTGACGGCAGAACATCAGGCGTATCGCTCTGTCAAATCACAGTGCAAGTTAGCTGTCTGACAAAATCCCGTATGAATAGGAAAATAATATG
TGAATACTCACCAAGGCAAACGTGGAAGTCTCAAGAACTTCCCAGCGATCGGCCCTGTAAAATATGCTGTCGCGCTCGTTCCATTGGCAATCACCCGCAC
ATTCGCCCGTGCTCGCGAACGAAAGCTGGTCCTCGAAAAACTGGATTTGGTCGGGTGCACCTTCTTGGGTTCCGATGAGGTCTGGCTCGTATTTCTCCAC
GAGCTGCTTGGCACGGTCCTTGCGTTGTTCCCAGCAGCCACTTGGACACGGGTCGTTGGCAATCGACGTACGCAGATTGAAACTCATCACCTTCAGTCGA
GAAGCAACGTCGTAACTTGATCCAGATGCAGCACCAACTGCGACGGCGACAGAAAAAACAGTAGCGAGCCGCATAGCAGGCCGGCGTGGGAAGACAAGGA
TGGCGGGGTGGATGCCAGCG