Description :
From Genome Similarity Track
Location :
Scaffold_175:49514- 54085
Transcript NameFunction/comments
g14247.t1ETM40749.1 TKL protein kinase [Phytophthora parasitica
g14248.t1RAW26745.1 hypothetical protein PC110_g16859 [Phytophthora cactorum

Sequence
4571 bases(100 bases per row)
GCGGCGACTGCCTGCGCGTGCTGCGCTGAGTCTCGTGCTTCTGCTGCTGCTTTCCGGCGACTGCAGGGCCGCGGGGGACCTCGTGGCGCGTCTTTACGCG
CTGGAGACGTCTGGCAGCTCCGCGAACAGGCTCTCGCTCAGCTCCAGCGCGCTGCCGAGCGCTGTAAGTAGCAGACTATCCAGCTTTTCGCTGTCCTGGA
GCGACCTGCCGGGGCTCATGCAGCGCGCGCTGCTGTGGGACTCAGGATTCGTGTTTGCGTCGGCCGTCGACGCCTCGTCATCAAGCACAGGGGACACGAA
ACTCGTGCAAATTTACACTTCGTGCGGCCAGGGGATGGGCGATTTGCTGCCGGACGTGGAGGAGTTGCAGACGCTGACGAACAGCAGCTGCAAGCTGCAA
AACTGCGGGATTATCGGCCATTTCCTGCCGGAAAACTGTCCGGTTAAGCAGGTTTTGCCCCTTACCAGGTGCGCAGTGTACGCGTCCGCTATGGACACAC
AGACGCAGTTTGCAGGCGTGTTTTGGGCCCAGGACGGACGCAGCACTAGTGTCCCTGAACCCGTGCTGAGACGGCATTCCCCTCCGGCGACGCAGCCGAC
GGACTCGCTCTTTGCAGTGCATTTGACAGACGCGAGCTTTACAGGGACAGACTCATGCCAGCCGCTCACGAACTTCATTCTGCCGTGTCGAGGTGTGGCA
GATGACGTGGATATCTCCAGTCGTAGTGGGAGTGCGAGCTTTACAGCCAATAGCAGCAGTTTTACGGAGATGGACCTGTGTCCGGCCACGGAAGGAGCAG
CTATGAACGCGTGGCTTGAGCTGCAGTCGGTTCCGTCCCCGGGGACGCTCTCCACGACGGCCATTGTGCTGCTGGCAGTGTCTATGTTGATTTGTGTGGT
GTTGGCCATCTCGGTGTGGTGGCTGAGCCGATCGCGGGCGTGGCTGCAGGACGCGTACGACCGCGTCATCTTGGAGGGATCGTGGGACGACGGTAGCTGG
TCGCCGACGTCACATTTACTAGGGGGCCCACTCGCTCCGTCTCTAGCGGTCGCAGGAGCTACAGATGAGGAACGACTCACGCCCATGGAGGTTTTCTTCG
GAGCACGACCGAGAAGTCGACGGTCACCAGGGATTCACGGCACTTCAGCACTCGTAGCCACGACACGGGCCGAGATCACGCTGTCCAACGACCAGCTGTG
CCGCAAGAGCGCTATCTTGCGCGCCTTCGTGTCGGATCCGGCCATCGTGACTAAACGCATTTCGTTTGCGCAGCTCCACTTTTTGAGGCTGCTCGCCAAA
GGAGGCAGCGGGGAGGTGTGGCTGGGCCAATATGAGACTCGCTACGTGGCTATGAAGTGTTTATTGCCAACGAAACGAGAGGACCCAGAGGCCTTGGAGC
AGTTCGCAGAGGAGATCAGGATGGCGTCGTTTTTAGCGCACCCGCGGATCGTGGCCTTCTGCGGCGTAGCCTGGCAGTCGCTCTTGCACCTTTGTGCAGT
GACGGAGTACATGCCACGCGGTGACCTAGAAAACCTGCTGGCAAATCCAATTGCTCAGAAGGAGCTGAGCTGGAACAGAGAGAAGCTCACGCTGAGCAGT
GATATCGTCGAGGCGTTGGTGTACTTACACTCGCTGGTGCCCATCGTGATTCATCGCGATCTCAAGTCCAAGAACGTGCTGCTGGATCGGCGATTACGTG
CAAAGCTGAGCGACTTCGGACTGAGCCGCGAACGATCCGTGGAGGACACCATGACCAACGGCATTGGCACGATCTTGTGGAGTGCGCCAGAGGTATTAGA
GGGCAAACGCTACGACGAGAAGAGTGATCTGTTTTCGTTTGGTGTAGTGCTGTCTGAGATCGACACGTGCGCGCTCCCGTACGGCTTCAGCCGCCACGCC
AAGATGCGCAGTATGCAGGTCGTCCACCTCGTATCCGAAGGCAAGCTGCTTCCCAACTTCCGGGACGACTGCCCGCCAGCAATACGGGCGCTCGCACAGC
GATGCCTAAGCTTGGACCCTGCAGCGCGTCCGACAGCAATGGAAGTCGCCTTCGAACTGCGCTCTTCCATTGCTCCCCAGCTACTGCAGCAGCCGATGAC
GGCACTGTTAGTAGCGGACGATGACGGCGCTGTTAACGTTAGTAGCGCGTCAACTCCCCTCACCCAGACGTCTCCAGCCTTCACAGCAGTCGAGAACAGC
TCGACGCCACCTGTATCATCATCAACCGAGACCGCAAACACGAAGGAGACCCAAACGGATCCGTGATCTTCAAGACGAAAGTAGTCGCCAACGGTTAGGA
ACGCGAGCCTTGGCAAGTCGCGTACAGACCAACGGAAGCCCATTAATTTATGAGAACAAAGCTTGTAAAAACCTGAGACCGTCGCCACCCAGCAATAGCC
GACTGAACATGCTGACACTAGCGAAACGGACGTGATCACTGTCTCGGTGAGCCTCTGGATGTGGAGGTGGGAGACGTGGGTTTCCACACATCGATAGCGC
CATGGACAATGACCATGAGCCATCGACCTCTAGGGCGCGCAAAGCCCTACTACTCCGTCGAGTACCGATCCTGGCACATGTCGTGAAGCAGGGACTGTGC
TCGGAAGGCGAGTTGCTGCGTGCATTGGAGTACGTGACGTACAGTGACGGAGAGTACATTTATTGCCAAGGCCAGCCGGAACGAGACTTACTATTCATCG
AGGAAGGCAAAGTTTTGATCACTCAGCGTCGGCGATCTCGTGCTATGAGCACTACAGGTAGTCGCCCGGTGGGGTTTATTCCGATGGACAGCTCGGGCGG
TGTTGTATCCTCTCGGCGGCCCTCACGACGGCGCTCGCAGATTGAAACTGAGATGGAGATCCAGCTACACAAGCACGAGGAGCTCGAATACTTTGGCGAG
GAGTCTTTGCTGCAAGGATTGGTTTCTAGAATACTCAATGCGGTGGCTAGTGGAGCGGTGACGTGTGCCGTACTCCCAGAGGCTTCATTTGCCAGGTTGC
TGGCACCGGTACACGAGTTAATGCTGCATCGGCATTTGTTGCGAATGCACGGCGTGCTGGCAAAACAGCGAGTATTCCAGCACTTCTCCGCTCGTCAACG
ACAGCACATTTTGGATCGTTGTACTCTAGAACACTACGAGGAAGGAGCTCGAATCATTCAGCAAGGTGATAAGGATGACGACCGGTATTTTATCTTGGCC
GAAGGGGAAGCTGATGTTGTGCTAGATGAGCCCTTGCGAGATCTTCGGCCAAATAATTATGCAGAGGGGATTGAAGGGTTTGAATATGGCGGAGAAGAAG
AGGACGGTGGGGGCAGTAGAACATCGATTGTGTGTCGAAAGGCGCTTTATCAAGGATTTGGCGAGATGGGGATCTTAGGCCGGCCTCGAACAGCGCATGT
GGTTGCTGCTGGGAGCGTGGTTTGTGCAGCGATTTCGCGAAAGACGTACGTTGGCGCTTCGCAGTTGATAGGCGTTAGTGGCGTTGATACGGACGCGGAG
GCACTGCTTGCTATGTCTCTGATGGAGGAGTGGGCCCTTGTGGTGAAAACTCGGAGCCTCCATTTGGCGAACCCGTTGGTGTCTCGACATCTTGAAACCT
TTGTGAAAAAGTTTAAGGCCGCCTACATGCAGAAGTTTGAAGGCAAAACGCTGTATCTAGACCTGCTCCGACGAATGCACGCAGAGCCTTCACTTGCCGA
TGAATTCCCGTTCGTGTCGGACCGAGTGGCTTGGGATGCACCAACATCATCGCTCAGTATCACGCGAGCTGAGACTCGACGCGTGCTACTGCTGCCTCCG
GCTGACCGCTCCCCGTTCGAGATCAGCTTCATGGCGCGCTTGCTCGAGCCTACAGCGTTCATTGGGAAGTTTGACCGGCCAGCTCATGTCGATCAGCTCA
CGCTCGCTCGCGGGATCGCTCGATTTGCCTCGTTTGCCACCATCCAAAAGGACAAACACCTCTTTCGTCAAGGCAAGATCGAAAGCCGCGCCTTCCTCAT
CTTGCGAGGCAACATCAGCATCGTGAACGAGGACGTGAGCACCATTCAGACCGGTCTCGCCGTCAAACACTACGACGTACTCGCCACACTCTCCGCCGGA
GACTCATTCGGCGAGCTCTCACTTGTAACGCGACTCCAGCGTTCAGCCACAGCTCTGGCTGCCTGTGAGGCAGATTTGCTGGTACTAGAGCGTCCGCATT
TGCAGGCCTTGATGGCTCTGCTACCAGGCGTATCGGTGCAGCACGCCATGGTGGAGCGCGCCGAATTCCTTGCAACGCTCAACTTTCTCCGGGACAATGA
CTTCGCGCAGTGCATTCGCGTGGCGCATGACCTCCAAGAGCAGTTCTACGAGCCACGCCACCTTTTCCTCCAAGAACCCGTGCACTTGCGTACGCTTTAC
ATCGTCAAGAGCGGCGAAGTAGTTGTGTTTCTGCGTCGGCACGTGCCAGTTGCTGAGACTACAGGGACCTCAGGAGCGAATGACGTCGCACCGACCAAAG
AAGTGCTTGTCCGAGTGGCAACGATTGGACCGCAGGAGTTTTTCGGTGTCGCCATTGCCAGCGCCAACATG