Description :
From Genome Similarity Track
Location :
Scaffold_1900:4950- 6247
Sequence
1297 bases(100 bases per row)
AAGCAGGGAATCAGAAGATTATACTACACCTCAGCGAATCTCCACGTTGTTCTTCCACTCTAACGCCCCCCCAGAAATCGTAATGTAGTGATGCCAAACT
TCTTTGCTTTCTTTCCGCTCGATTTCTGCTATCATTTGTGCAGACAAGTGATGAGGCGGCTCCCACGTTAGCTTTTCCTAGCTCCTTACCATGACTCTAA
TGATTACTAACATGTTAGTTCGAAACACTAGACACTAACATAGGCTTAATTGTATTATCTACAGCTACTTTCAATGCTGCAATAATTGTTGCGTCAGCCA
AGCTCCACGCTCCACGGTATTCGATTTCACTCAGTATCATTTAGAAAATGCGGTTCATACAGCCCATGTTTTCACATGGACAAACATGGCCTAAGAGCCT
GAAAACATGGGAAAACATGGGAAAATAGCCATGTTTTCTTATGTTTCACTAGCCGATTTGTAAACCCACCCCTATCGTTTTAAGTACGAAGCAAATCCAT
ATTTGGGGTCTCGAAAAACTTGTTGAAGACCTAGCGATTGATAGCATAGGTGTACGAACATAATCATACCCTCCTCGTACAGCCCGCGGTTGGTCTGAAA
GATAACGTATTTGGACTTTCCGATTAAGGCGTTGTAGCAGCATGAGGAGGTTCAAAATACGAGATTTGGATCTTTTATGCAAGAAAGGAGCCAATCAAAA
TGCAGGATTGAAAACATGGTAGATTTCCCGTTTAGAAAATATGGAACTTCAAAAAAATATACTCCCTCCGTTTCACATTACTTGGCAGATGCGAGTAAAT
GTTGTCGGCTATCGTATCCTACCAAGGTAACAAATATTGTAACATAACTCGAGACACCAGCGTTCTCAGCTACAGTACACGGACGGTTGTGTTGGATGAG
CTGGGCTTTTAACCCCCGAGCACGAGTGTTTGCCAGTTTGTCGATGGACCATGTGGATTGAATTTGCACTGGGGCAACGTACTAATCGCGAAGGATGCAT
GACAACGAAACAGGTAATAAACATAGCAAATCAACGAATCCATACAAACAAACTGAATATCGGTAACAGATTGTACTGACGCAAATTATCCTTTTCAGAT
CGACTGAGCAGAACGGCATGTACTAAAGGTCGAGGCCTCCGAGACTATGATATATtagtagtaatacttagaacattacgccggcagtttttttccttac
cgtaatttactACCAAGAAAATTCCTGGAACCTTCTTTCGGGCCAGCTGcaatttcgacgacgcaacctctcgaccacctgagagcgaaaCCAACGC