Description :
From Genome Similarity Track
Location :
Scaffold_412:495- 3321
Sequence
2826 bases(100 bases per row)
ACCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCGGGTTGTAGAATTCTTCCATCGGGC
ACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCCATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTT
CCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGTACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCC
CCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGT
CCGAACCGTCGGATCCTGATTCGGTTCCTGAGTCGGGCGCCGTGACTTAGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTT
GCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTC
AGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCC
GTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCC
ACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTTCCTGGCTGGCCCCGCTAGCAG
ATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGCTGCTACCACGG
CTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTC
GTGGAGCACTTGCACTTGTAGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAA
GTGTCGGGAGAGCCTGTGGCCGTCTGGTCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCC
GGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCGCGCTT
CCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGC
TTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATG
AGATCCAGGTCTAGCTCGAAGATATCCTCTGCATCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGATCTATGACTGCCACCAACT
TGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCG
TAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTC
CGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCAT
ACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTT
CTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTC
GTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGG
GCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCC
CCAGATGATCTGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAA
GCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGC
TTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTGGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTC
CTGTGACGGGATCTTGAGAGTTGAGA