Description :
From Genome Similarity Track
Location :
Scaffold_593:495- 2162
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_593-snap-gene-0.6Protein phosphatase 2C

Sequence
1667 bases(100 bases per row)
ACGTGCCGCCCGAGGCGGATATCCGCGCGTTCTCGGTGCCGCTGGACGGAGAACTGTTCCTTCCTGTCGCCAACTCGCGCGCCTCGCGCGTCAGCTGCGC
CACGTACAAGGCCAACTTCCCGATCGAGGTGCGCTGATGTGGATACGCACCGGGAGTTTCGGTTGGGAGACTCATGGCCTTGATGGTGTGACTGCAGGAC
AAGTTCAGCATTCAGACATTGGACAACGGAGACGTGTTCGCGGCTGTTCTCGACGGCCATGGTACGCTCCTCTAGAGCTGATGTTGCACTGCGTGAGTGC
TGACTGTATTGGTGTTGTAGGCGGGTGGCAGGTGTCCGAGTATGCGCGCAAGTCGCTGATCGGCAATGTCCAGAAGGAGCTCGCTTCTCTGCGCAAGGGA
GACAAGGACAACGAGTCCGAGTCGCGCAAGCCGCTGTCGGACACGAAGATCGCAGGCGCGATCCAGCGCGGTTTTGGACGCACGGACCGCGAGCTGATGG
AGGACGTGGCCGCCGCCTTCAAGCTGGGTTTCGGTGCCGTCGCTCGCTGCGGATCGTGCGCGCTGCTGGTGTTCGTCAACGGCGGCTCGGTCCACGTCGC
GAACGGTACGATGCTGCTGTGCTGCTGTGGTGATTGGATTTCACCCTTACTGGATGTCGATGCTGATCCTGTGTTTGTGTTCTTGCAGCTGGTGACATTC
GCGCTGTGTTGGGCAAGAGTGATCCGGACAGCACCGATGGCGGGATGCTGGCCGTGCCGATGAGCCACGACCACAATGCCATGTCTCTGATCGAGCAGGA
GAAGCTGCGCAAGGACCACCCTGGTGAGGCCAATGTATTCACGTGCCGCCATCCCGAATCGTGCTACGTGAAGGGAGCTCTGCAGCCGACGCGCGCGCTG
GGTGACTTCTCACTCAAGTACTCGGAGTTCAATGGTCCACCGTACGTGAACGGAGACCGGAGTGCTGGACGCCATTTCCCGGTGCCGTACTCGCCGCCGT
ACATCACGGCGATCCCTGAGATCAAGCACCACGCGCTCGAGAGCGGCGACAAGTTCCTGATCGTTGGGTCGGACGGGTTGTGGGACTACCTGACGAACGA
GGAAGCAGTCGAGGTGGTCCGTGAGCATCTGCTGGCGAAGAACCACGAGCTCGCAGGCCGCGCTCTTGTCGAGCGCGTGCTGCAGAAGGCCGCCAAGCGC
TACGACATGACATACCACGACCTGCTCAGTCTCCCGGCTGGCAGTCATCGCCGTCGGCGCCACGACGACACAACCGTGGTTGTCGTCTTCTTCGATTAGC
AACGTCGCCGGGAGAGCAGTGAGAGGTGCGTTGGTGAATTAAAGTGTCACGAAATTGGATGAGGGGTAGCGACGAAGAACAACGAAGTTTGTGTCCCTCC
ACTAGAAAGAGCTGATACAGAGATCACGAAGAGCACATGAGGTGTACTGGAGACAATCGAGATTCCAGTTCAACCACACTCGCAGTTGTCCCTTTTCGCA
TTGGCGCTTTTGTGTGCTGTGGGCAGGAAGGGATGCAAGCAGTCTGGATCGCTGTGGTTAGCTTGCTGCTGTAGGTAGTGCTGCTGTTTATCCAGGTCCA
GCATCAGTGTCGGCTGCTGGTGTCGGCGTGGCGCCAACAGTGAGCGTCACTGGGACGCTGCCTATTG