Description :
From Genome Similarity Track
Location :
Scaffold_1737:495- 1792
Transcript NameFunction/comments
Phymu_g13598hypothetical protein

Sequence
1297 bases(100 bases per row)
CAACTACATCGCCTGGAAACGGTTCCTCTTACTTCGATCTCGGAGAAACTAGTACAGGAACGTGCCACAGTACGGATCCACTGCGTCTACCCAGGTTGGA
CCTCGTATCCTTCCCAGAATACTTGGAATTCACGCCGGATCCAGCCATACCGTTGTCCCGTCCGGACATCCGTGATCCGCTTGACTTCGAACTAAACGTC
CTCAAGGCCGCGATCCCAGCCGTCTTCAGGTAACAGTTTCTCGTCGAAATCCAGACGACCCGCCTGGCCACGGTCCTTGGTCGCTCTGGAAACATCCTGG
CTGGCTTGAGCTATGTACGACCGGAGACAGGTGGTCATCTGCACCGGCAACCTCCAAGCGAACGGCATATTCACTCTCCATCTCTGCTACGCGGAACGGT
CCGTGTCACATATGAGCTAACTTGTTAGCGTACCCCTCTTTGACACTGTCCAGGAAGATCAACACCTGGGATCCGGCCTCAATTGGATGCTGAGTCGCCG
TCTCGTTCTCCCGATCGGCGCGATCCGAGATCGCCAGCTTCAGGCGGTCGTTCACCTAGCCAGTTGGTAGTGACGTTGGATCTAGTATCTCCAGCGCCGC
GGACCTTATCGCGGCGTCCAGTATTTCCGAGAGATAGCGTTGCTTTTAGAGTCGTCTTGGGATCCCACCCATGAGCGAGATAGAATGGCGCGTCTCCCTG
GCCCGATCTTGCGCGGTATTCAACGTAAACGTCAGGTTCTCTTAGTACTCGTCCCAGTCTCGTTGGTCTGAATCTTGGACATACATCTTGATGGCTCGGG
TAATTGTCTGTACCATCCGATCAACAGTGCCATTCGATTGTGGACGGTAAGCCATAGTGGCTTTTTGGCGCTGAACTAAGGTCCGGTTGAAGGCACGGAA
GAAGTCGGACACGAACCCGGGCTCTCGGTCGTGTCGGATCACCTGGCTGTGTTCCCTCTCACCGATCTGGACAACGAGGGTATGTGATCCATTGCAATCA
CTTGGAATGGGTAAGTGACCTGAAAATGGCCTGATGATAAACCTCGGATCGTGGGTCGCCCCTAGCCCGCCTCGCAATCTGCACACTCGCCAACAAATTG
CTGTAACGACTTGAATAGTCCTCTCAGTAGAAGTGATCCTTGATCCTCTGGTACGCCCTTCCAAGTCCTTGGTGGCCTCCTTCAAGACTGACGTGGCGGT
agtgcagcagatccgccTGTACCGTGTCTGGTACCACAAGACGTAGCAACCCGTCTCGTTCAATTTCGACCTTTCGCGAGGGTGAGCAGTAGAACAG