Description :
From Genome Similarity Track
Location :
scaffold_132:49495- 50790
Transcript NameFunction/comments
g4288.t1 conserved hypothetical protein

Sequence
1295 bases(100 bases per row)
TCCTAAGGCTTCATACAAAAATTGAACCCAAATGAAGCGGAACTTAGGATATCTACTTGTAGAAAAAGGCTGCTACCTTCCCAATTTGGGGCTCAAAGCT
TGCCGCTATCCGTGCACTGCACGTGCAGGTTGCCCAGGTTGCAAGGCTAATCAACACCTTCAAATGGACAACACCGGCACAGCCTGCGCGGGCGGCGAGC
TGACGTGCGTCCTGGGCTGCCGCACCGGCAGCTGCGTTTATGTGGGGGCTGCGGACGGAAGAGTGCGCGCGGTTGCCGCGAACGTCTCGGGTGAATCAGG
TCGTAGCGGCAACGAGCTGCACGCGCTCTGGAGTCTCCGCGTGTGCACGCACGGCGTCACGGTACGTTGGATGCAGCGGGTCGACAGCGGCGGGAGGCGT
TCGCTGTGCGTTCGCCAACGGCGTGCAGAACTTGACCTGGAGTGAATGTGTTGCCGTTGCAGAGTGTGTGCGGCGTTGAAGCCGATGAAAAGGACAAGGG
CACTTTGCTGCTGGTCGGGAGTGCAGGTGGGGAGCTCGTGGTGCTGCGCGAAGAACTGGTATGTTGGCTGGCTTAAGTTTTTTTTGGTTTTGATGCAGTA
CCGGTAACTCGGACGTTTGTTTGCAGGAGTTGCGGCGGTTCCAGTTGGAAAGCGCTGTTCAGCAAATTTGTTACGACCGAGACGGCGAGTTTATTGTGGG
GGACTCGCTTGGAAATCTTTATGCTGTGACGCAGTACGAGATCCTCTGGAAGGTGAGCGATGGTAGAGAAGCTGTGGGTGAAAAGTGGACTTACGCCGGC
GTGTGTGCAACAGAGACGTATGACTGTTCCTGTCAGAGACGATGGAGCAGAGTGTTTCTATCCTGCTAACGCTCAGCCAACGGTGAAGGCCATTGCGCTT
GCCAAGCTGCTCGATGTCGAGAAGACGCTGTCGAATTATGTTATCGTTGCTACCGGTCACAAGCATTTACTGATGACTCATCGTGGCCAAGATTTCGGTG
TGATTCCCACCCGTACGCCTATTGCAACATTGACCAGTATCCCAGGCGAAAATGAAGATGTTGTGCTGGCAGCGGGAGAAGAAGGGTGTGTATTTACCAA
GTTTTGATGCATGGATGGCTATTCTAATTTTTGCTTCATGACAGGGTGATCTATCGCCTTGTGAGCTGTCAGGGTACGGATGGGCACGACTTCCGCTTCG
CCGTTGAAATTTATGCCAAGGTAACGTTTCCCGTCGCTAAGTTGCTTCCAGTAAAGAGGCCAGAGTCCACCGTTGCGAAGGCCTCCACTTTTGCA