Description :
From Genome Similarity Track
Location :
contig_8:494837- 496338
Transcript NameFunction/comments
g1640.t1hypothetical protein PHYSODRAFT_330222

Sequence
1501 bases(100 bases per row)
AACTCACGTTCAGTTTTGCTTCAAGCTCTAAATGTCCTCCCTGGGCCGCCCTAGGCACCCACAGTACGACTGAACCGCCTCCTGTGCCAGGAAGACCCAA
AAAGCCCGGACGCCAGCGGTCGAGGTACAGCGTCTTGCCTCCCAGCACTTTGGTAGTCGACGTCCACGTTGCGCTTCCACCTGCAGCCACATCGACTTCG
TCGATCTTGTCACCACCAGACATGATGTTCACTTTGACGTCTTTTGTGTCCGTACTCGTGAAATTAATAATAACCGCACCGTCGCCCTTCCTGGTCCACG
AGCTCGTGCTTCCTTTGAAAGCGCCTTTGATGGTGTGCAAGCCCAGGGTGGCTGGTTCCGCTCCGTCATCGATCTCACCCATGAATTGTGTGGGCCCGCA
GACAGTCTGCACGTACGCGATAAGCAGAGTCGATATATCCAGGTCGTCAAACCCACTCGCAGAGAGAATAATCAGCCCCTTTTGAAGAGCTTGGTACGCG
GCATACTTAGCTTTCAACGTCGTGCCGTTATTGCTCTCCCCCGAGTTGATGAGGTCGTTGATGATGACCCCGAAAGTCTTGCGAAGAGTCTCGCGCGTCT
TGTAGGCGGTCGCTTCGCTGGATTCAGATATCATTTGGCTCATGCAATTGTTTGTTACCGTGGGGACGTCTTGTAGCACGAGGTCGGACTCGCTGATTTT
GAGGCGGATCTCAGCGTCGGTGACGTCAGGGTTCTTCTCCCGGTACTCATTCACGGTGAACCACGTGCGATCCACCAGCGACTTTAAGTCGGCACCGCAA
GTCGAGTTGGACTTCATGCCCGTCACGAGTGACGAAATCTCCGTCGAGTTCAGCTCATTGGCAGCCTCCGTGAAGTTGGCCCCCGTGAGGAAGGCCTTGA
ACTTCTTCCAACTGGAGATGATAGTCGCGTTGTTGGATAGAACTTGGCTCAGGATGTACTGGGTAGTCGCCAATAAATACTTGCTGTTAAAAAGAGTTCG
CGGGACGGTCTTCCCCAAGCAGTTGATGATAGCGATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGCAGCTGGGCTTCCGTGGTC
TGCGGATCGGACGTCTTGATGTTGCGTATGTATCTGACGAGTCCTCTCACCACGGTCATCATCGAGTTGGCGCACTTGACAGCTCTCTTCGCGTACTTGC
CTACCTTCTCAATCTTACCGAAGATGCCCATGGAGGCAGTATCTAACGCTGTCACCGCAATAACACTGATTTTGTTGAACACTTGCAGCTTGCAGTCGTC
GTTTTGTCGGATGCATTCCATGCCGCACTCGACCGGGTAGTTGATAGGGCACTCCGTCCAGCAAGTGTTGGTCGCGTCGTTGCGGTCGTAGTTGCTCGGG
CACTTGTCCATGATATGTGCTTCTCGGTAGCACGCAGGGTCCGGAGAAATGCTCCACGGGCCCACCCAGTTTCGGTACGTCGAGGTGACTGTGCTGATCG
C