Description :
From Genome Similarity Track
Location :
contig_61:49481- 50919
Transcript NameFunction/comments
g10845.t1hypothetical protein
g10846.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
GGTACAGCCGCGACACCACGGGGATCTCGTAGTACCATTCCAGCGGATCGTTCATGCTCGTCGACGTCCTCTTCCTCAAGTCTTTACGAAATGATGACAC
TTGGCATTATAGCGGCCCGCGGGCCTGTTTTGTCAAAACCCGCGGGTCGGTCGCCGGTCTTTGTCAGAAGTTGAAGTGACCACCACTCTGGCATTCCGCG
TTAGACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACGAAGGTGTCGGAGGACGTGGCAGCGCGCATCGAGCTG
ACGCTGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGCTACACGCCTCTTTCCTGGGGCTAAATGAGTGAGTCT
TAACGATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGGATCCTTGCAGACCTGCAGCTGTGGCACGGCCGACAT
TTGCATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTGTGGCAGAAGTCGCTCATTGATTCAGAGGTGTGTGGT
GTGTGTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGTGCTGTGGCTGCAGATTGAGATGCTGCTCCGAGGAGG
ATACAAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAACAGAAGGAAGAAGCGGCGACTGCGCAACCTGAAGATGCAGACGTGAATAGGCAC
GATCTGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACTTTTTGCCGCAAAGGGTGAGTGGTCCTTGCATTAA
TTGGTGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGCATGAAAGTCTTTGGCGAAAGTCGGAGGCAGTCGA
AAGAAAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAAAAGAGATGGATGCAGCGAATAGAGCTCCCAATGT
TCATAAAGGTGCGTCGTGCAGGAAATGCAAAACAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTTCAATGCAAGAATGTGGATTTGTGCGCTCGATGC
TTCAAGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTCCAGCTTTGCGTGACAACCAGCCCCGAACAGCAA
TCAGCTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCTGCAGCTGGACCAAGGAGGCAAGCACCCTATTCA
AGACTACCTCGTGAAAGTGCTGCCAGGCACCAAAGTCG