Description :
From Genome Similarity Track
Location :
contig_161:4948- 28144
Transcript NameFunction/comments
g14470.t1hypothetical protein
g14471.t1hypothetical protein
g14472.t1hypothetical protein
g14473.t1hypothetical protein
g14474.t1hypothetical protein

Sequence
23196 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACCTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTCATCGACAT
TCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGA
GATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGAT
TGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCC
AGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAG
GGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCG
AATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGA
ACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGG
CGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAG
TCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCA
CCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTC
GGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGG
GCGGCGGAGATTCGTCTCCGGCACTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTGCCTCGTTGCTCGGCTCTCAGC
TCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCT
TCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTAC
TTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCCCCGATCCGGTTCAGCTCGACCAATTCT
AATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCA
AGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTG
GATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTT
ACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTATCCACCGTTCTTTT
CGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCC
TTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTG
ACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAA
AACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTT
CATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCG
AATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCCGGCGAAGCTTCGTTTGGCGCCGAG
AGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCAC
CGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGGCTTC
GTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAACGTC
TCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGCCGGTCGAACACCGGCACCAACGAGGATTCATCCGGTTCTCCGG
TGGAGAATGTGGTGGAGTGGGATCGCAAAAATGGATGATGCGATCCAAACTCACCAGCGGTACGCCCGGACTGCCGACTTTCGGAGGGGGTACTCCGTTG
ATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGAC
CAAGGCGGAACTTGTTGGAGCTGAACTGCTCCTTCCGGGGAATGGGGGATGACAGCCACGCGGGTATCCTTCACGCGGTCGTCGGTTGTTGGTGATCGGG
TCTTGGGGTAAGTCGATCACGTGGGGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGAT
GAGATTGTACGATCGCCCCCTGGCCAAGCTATCCAGGTGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCTTC
CCCGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCG
CTTGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCACTG
TACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGGATGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAGTGTCCGGAT
GATCGACTGTACCGAAAGGGTGGTACCAGGTAAATAAAATTACCTGTACCATCGTTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCAC
CAACCCCAACCCTTCCGGTCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCAATCGCCCCCTGCTCTGCG
ACCAGCCGTACGGCGGTTGGTCTCAGCGCACTCCGTCGCAATTCTGCTTCTTTCTCTGAGCCACCACCAGTCTCCGTGCTAGATCCAATCATGGCTGGCG
CGAATGATACTCCACCCGAAGACCATCCCGCTGTCGCGTCTGGTACGTCCGCTGGCCGCACCTCTGAGGTTCCAGTCGTCCCCACTGCTCGTGTAGCGCT
CCCTAGCGTCGACCTTAGCGCCGCCCGAGAGTCTCTTGCAGTATTCTCGTCCCTGATGGAGCGTATTGAGGCCCAGGCTGATCTCAGTGACGATCACGCG
GTATTGCAGCAGGCATACCGCGACCAGGTGGCGCGTGCTGATCGGTTTGAGGCCGATTTGAACGCTGCGTACGCAGCCGCCTCTCCGTATGTGTTGCATT
GCCAGCATCAATACGATCTCCTATTCCGGCGCTATCAAGAAACCCAGCAAATGGCGGCCGACTTTGAAGCGGCAGTGCGCGAGCGTCTCGAAAATTCGCA
CGAGATCGCGGCCATGCGGGATCGTTTGCGCGTTGCGGAGGAGGTCCTCGCGGAGGAAACCACGCGATTACAAGCGGAGATTGCCGATCTAACTCGTCGT
CTGGCTGATGCAGAGTCTCCGGCGGCTAAAAAGCAGCCGCAGGGGTCAGCACGTCGTCTCGCCACATTACAGGAAGGGTTAGACCAGGCGATCGCAGATC
GCGACCGCGTCGTTTTGGATTTGGCCGAAGCCAACAAGAACCTTGGTGCACTTGAGTCGTCGCAGCGTGCACTGGAAGACGCGACGTCTCGACTACGCGG
TCAAAACGAACGTCTCGAGCAGCGCGTGTCTAATCTTCAAGCGCAGCTGGCTCAACAAACAGCTCGGGCCAAGCGGAACTTCGATCGTGTTGACGCAGAG
AGGGTACAGTTCCGTTCTCGTGCAGTGGCTGCTGAGGCCACTCTCCAGACCACGTCCAAGAATTTGCAGCGGATCATGGCTGATCGCGATCGAGCGCAAG
CCGACCGTCGTTCTACTCGTAAGTCCACCTCGCATCCGATACATCTTTCGTGCGTGACACTAACATTGTTCCTCTATTTGTTGTACCAGAGATCCAAGTT
GATAACGCGCGGGCTTCAATCGCGCGATTGGAACATGGCCTGAAGGCCTCGCAGGCAGATCGCAGCCGCATCAAGGCGCTCAATCACGAGAATGAGTTGC
TCCTTGCTGACTTGGCCAACGCGCAGTCTGCGTCTTCTGCTCTCAAGAAGGCTTGTGACCGTGCTGTACAGGACCGCGATCAGCTCCGTCATAGGGTGGC
GGGGTTGATCTCATTCATCCAACCCGCGCAAGACGAAACGCCACTTACTTCCTCTTCCAAGTCGACGCCTGCCGCATCCAAGAAAACGGACAAGCGACCG
CGCGGTAGTTCTTCGGCTGGCAGCTCGAGTCCGCCCCGTAGTCGTCCGCGACAGCGATCCCCTAAACCAGTGTCGGAATCAAGTACTGTTCCGCCTTCTC
ACGGTGGATCTGCTTCGCGATCTCTTTTCCTTTCGGGACCGTCAACTCCTAACTCCGGCAGGCTCGCTGGTGGCGATCACTCTCCATCTCAGCGGTCACC
ATCGGTTAACGCCTCCCCGACCAGTAGTGACGACGATTCTCTGTTGGCGGCTCTCGCAAGTTCGCGATCGTCCGGTCGTCGACGTTCGTCTTCCACCGGC
AGCCCTAGCGGTCGATCATCCAGCCGCCCCATCGACATCGAGTCGTCCAGTTCTTCGGAGGCTTCGAACCAGGATCCTGATCAACTCGAAGAGTTGGAGG
ACGACCCTGGCAGTGCCTCTTCCGGTGACGAGAGTGATGGTGGTGCGGACATGCGCCACGTGATTCCGATCGTGGCAACGAGAATGACGGTGACAGTGAC
GGAAGCGTAGCTGATGAACCGCGGGCGCACCGCAATCACCTACTCACGCAGGTTGCCCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGTGCTATCTGGA
TCCCTGGATATCGCGCTCGTTCTCGTAGGGCGGCCGCGGACGTTCGCCCGTGGTCGGCGAGCGCTTTGAGCCGGGTCAGTGTCTTAGAGATGGACATCGA
GTTGCTCTTTCATCACCTGGCAAAGCCTACAAACTGGCTTTTTCCGCCGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCTGATCACCGAA
AGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAACGTCTTGGTGACGCCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGT
CTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGGGAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATA
TCTGGCACGTCTTTGGGAAGATCGCAAGCAGAGACGATCACGTTTCGGTGCCGTCTGGAAACGCTTCCTCAAGTTGATCCTGCAAGGGATGATTGCAGGG
CACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCCCCGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGGTTGCAGCTCTCAGC
CGTCCAACCTGGTAGACGCCCTACGTGCCGTCGATCTGGTTGACCCGTGGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGGCTCCCAACTGCC
CCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAGGTAGTTAGTGGATCGTATATCTTCTCAACATGATCTCCACGGCTTCTTCCTTCGTTG
TTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCTGATCGAGAACAGCCGTCCCCGATCTACACAACAATACCACATAGAACCCTTCCACCTC
AATGTGCGACCACCTCGCACACTGTTCACACCACTCCTCCGCCCGCAACAGCCAGCCTGCTACGAGCTCTCCTCCTCCACCTCGTGCGACTGCATCACAG
CGAAGCGATTCCGGTTGACGACTCCTCGCTCGTATTCGCGCAACAAGGCTCCGCAATTCAGATCGGCTTCATCAACCCACGAAAGCTGATCGTAACCCTT
CCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTACGTCGACCTGATCGCATATTCACGATCTTTTCCACCTCGAACTCGTCCTCATCGAGA
CCGGCTTCCCAGCTGTCCTCGGGTAAAAGCGCCTCATCAAAGTTGAAGCGATCTTCTTCGTCCACCACCAGCGTCAGCGTGGGGCGATCGAGGAACGATC
GCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTTCCAACCTTGCTGCATGATTGTCAAGCATCTCGATCAC
CCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGTGCATAGCCCTCCTTCACGCGATCTAGGTACAGCCACACTTGCATATTGGCCTCAATCCCATGA
GGTCGGACCTGATCATTATGCCCGTCTGCTCGTCCTTGAATGGCCTCCCGCAGGGACTCGTTAACCTCTTCTCTGGCTCGACGATAGTGGCTCTGTATAT
GATATCTCCACCGACGCGGGTCACGATCCCGTCGGCGCGTGCTTCCGAGAGGTAGCGACGCCTCTAACGTAGATCGCAGGTCCCACCCGTGTATCAAGTA
GAACGGCGTGTCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCGCTCGGCGTACTCATCCCAGTCCTGTTGGTTGACGTCTGCGACA
TACATCTTCAGCGCGCGTGTCAACGTTTGCACCATCCGTTCTGCCGTCCCATTGGCCTGCGGTCGATAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTA
TCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTA
GTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTTGCTTTAGCGATCACATAACCCGAGAACAGATCTACCCAGATCAACAGCTCCGTATTGCCTTTG
AAGGACTTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGGTTGATGAAGGCA
GACTTTGGAGGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCGGTATGCGGTAT
GGTGCGATCATTTCGATATGCGATCGTGGCCACCACTGCGATCGCGATCCCGATCGCAGATGGCGATCGTGACGTACCACTTTGGTGGTACACCCGCAAT
CATTCCGGAAGTAAAAGATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAAGGGGGGAGGTAGGAAGCTGAGGTCATTGTTGCTTTTTG
CTTGTTAGTTTTACCTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGTTGGGAAGTATATTGGCCCTCCTGACGA
CTTCGGACTCACCTCGTCGCGCAAGGTAATCACACGGGAGCCCCTGGATCGCTTTGGCCAGGTGTGCAACCACATAACCCCCCCCCCAGAAGACCCCGCC
ATAGGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACGACCGACGACCGCGTG
AAGAATACCCGCGTGGCCGTCAACCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGA
AGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGC
GTACCGCTGGTGAGTTTGGATCGCATCATCCATTTTTGCGATCCCACTCCACCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCA
CCGTGAGTCCACAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGA
TCCACTGATCGTGAGAGTGCCGGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTC
CCCTCGGGGACCCCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAG
TTCCGCACGCAACCTCGAAGAAGAAGAAGGCGAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTG
GACGGACGAGCAACTGGAGTCTGCCTTCTTCTACACGGACCTGTACAAGTTCCTGCACGAAGATCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGG
GAACTGCAAGGTCCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCG
GCTCCTTCGACGCGAACGAGCTATTCGACTTTGGAATTGCCAATCATCAGGGAATCAACGCTGAACCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGCG
TCGTCCCGGTTCAACGTGAAAGACCAACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGAT
CGAGCTGCAGCGGATGACACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGAT
CCAGCCCAAGCTCCCCCCTGAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTC
AACCAAACCAAGCCACCTGGAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATACGATCCGGATGACC
TGGGTGTCGACGTTACCCCTCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGA
ACTGAAGGAATTTCGGGAAGGACAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGGCGA
GAAGTGTCTGGTGTTTGGAGATCTGCTCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGACGCGCGGCAACTGGAAGAGCTTGTCTAAG
AACTTCCAGACTCAATACTGCGGACGTGGCGTGTCTGTCGCGAGACAATACTACCATGCGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGCACC
GTCTGAATGTCGCCGGTCTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACACGTCGATCACTTCATCGAAACACTCGACGA
TCGCGATCTAGCCAGCCAACTGGCACTGCTAAGAATTCCGGACGCAGACACTCTCGAAGAGACACTGCGATCCCGACAACGTGCGAAGGCGAGACAAGGA
AAGACGGTGTATGGGTCCATCAAACCCAAGCAGAAATCACCCACGGGGATCACCCCATCCGCGAATGCTCGCGCAGTCCGCGCAATCCGCGCAACGGTCA
ACTCGAGCGACTCCGAATTGGAAACCAGCGGATCGGAGGGAGAAGGAGACCTACGCAAGGTGTACTTCGCGGCAACGCCCGATCAGCCGACCAGATCGCA
TTCGGATCAGGAGCAACGCCGTCCTAGTCGAGACTCCAACGACCGTCGCCTCGATCGTCCAGCCGGATCTCTCGAGGGAGAAGCCCCGCGGAAGCCATGT
TCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAATGTGGCAAGAAGGGCCACCCGACCGATCGCTGTCTCT
TCGTCTGCAAGGCCTGCGGCGAGATTCACGGAGCCGGAGAGTGCCCGATGGAAGAGTTCTACAACTTGATCCGTCAATGGTACAACCCCACCAAGCACGG
TGGAATGCTCCCGCAAGCGGCTGAAAAGATGTTAAACTAGAACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCAT
ATGTCGAAAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACGGACAATACATGTGACCTTCATGACAAACGTACCATGGCGATCTCCAGCCT
CCACCAAGTCGACGAGTATTCGCGATCAGAAGTGACGATGGCTCTGGATCTCCTGCACGGAGAGTCGCGAGGATATTGGAAGTACCATGTGCCAGACAAG
AAATTCCGGCAGGCGAAAGCCATGGGGAAGATCAACAACGAAAGAGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTG
CTCGTAAGGTTGGGTGCTACATAGACAACAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGAT
CACGCTCGCTGGATCACTGGTGTACTACTTCGACGCGTGGGTTGGTCCGCCCACAGGTGGCCAAGACTTGATCCTGGGGATGGACTTCATGGTGCCAGCT
GGCATCCGCCTCGATCTGGCTGATGGATCAATAAATCTTCCAGACGAAGTGCGTATTCAGCTAGCCGGCCGACGTCAACTCTACGGAGAGAAGATCACGC
AGGTCAAGCTGGGAGAACATTGCCAGTTGGAAGTCGGAGAGTCGATCGAGATTCGGAAGGGTTTCATCTTGTCGAACCACCGGAAACTGTGGGTTACTCG
AGGAGATAGATGGGTACCGAGTCTGGTGACAGGGTTGGGGAAAACTCGCTATCTGAAGATCACGAATATCAGCGATCAGAAGTTAGTATTGCAAGACGAC
ACCCATGTCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGTATGCCGAGTGGCAGAATCTAGCTT
TCCAGTCTACTACAGACCGTGTGGAGGTAGAAGAACATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATCCT
GCGTCGTGACCGCGGAACCTCGAGATCGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAACAGAGGGGTCTCCAAGGGATCAG
GAAGGTGGCACCGGCGATCAGGACGCGATAGAATCTCCGCCAATGGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAAGGAGTCTATGCCCCAGG
CCGAAACGCCTCCGATCGTTGATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAGAT
GGCAATCTTGCCGGAAGTAGTGACCACCACCGAGGAAGTCACGATCGAGGATATCCAGGTGGGCGATCCTGAGTCAAACACCCCGGAAGAAATCGATCGC
CTGCGGCAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCATTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAG
GAGCAGCTCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATCAC
GCCGTCAACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTTTG
ACGAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACAAACTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCT
GGGTAGTCTCCATGACAGAACGCGCACGAAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAATGC
GCCACAGATCTACCAGCGATTGATTGATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAACCGATCGACGTGTTCGATTCA
GGCGAGCCAGAACCAGAGCCGAGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGAGA
AGGTTGAAGCACTGCTCGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGAAAAGTGGACTACTTGGGACACCG
AGTGTCCGTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGTAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTGGA
AGTTTGAACTACTACAGTCGGTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATGGTTCAGCAGA
ATAGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGACGCTGACCGCTGGGCCCGAGCGAAGATCGCGTTCACGATGCTGAA
AGCCAGGATCGTGTCCACCCCGATCCTGAAGCATTTCGACGCAGATCGCACTCCAGTGATCGTAGTTTACGCGAGCCAGTGGGCGATCTCCGCGGCTCTT
GTACAAGAGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATCGTCGACAAGGGAGTTTTAG
CACTCCTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTCGGC
TGGCTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAGATTCTGGGAGCG
ATGGCAGCAAGCATCACACCTCGCGCAGAAGTAGACGAGGCGTTGATCGCGATTGCCCCAGTAAAGCAGCCCCGACAGACGATCACCATGCCACCCCCTA
CGGTCGAAGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCTGCC
GGGATGGACGATCGTCACCGCCGCATCGGAGTATGTGCCCGATCTGACTGTGAACGAGGCGGAGTACCGCGGGTTGTTGTTATGTTTCGATCTGCTGTCC
ACGATGGACAGGGGGCAGATTGGCGACTCCAATTTAGTTATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTGTTGCGCGAGA
AAGCGATGGATCGGCTCAGGTCGTGGCCATAACACGAGTTCCTACACATGAAACGAGATTGGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGCTCTCCA
ACGGGGCGAAGGGATCGTAGTCACCTCAGACGAAGATCAACAAGACTTGATCACGCTCAACCGTTTGGACGAGCTCCTCAAGATGAGGGACGACGATGCC
GTCGTCCGTGTGTCTGCTGTGACCAGATCGACGCGACGCAGACGACTGACTCCTGAAGTCCTGCAAGAAGCGATTATACAGCGTATACGCGGTGAGCGAA
TCATCCAAGCACAGAATGAAGAGAAGTGGATCGTCGATCTGAAAGCATACCTGAAAGGGAACGTCGAGGCTCTCACCGCGGCCGAAGCTAAATCGTGCGC
CAAGGTCGCGAACGATTACGAGATGGACGAAAACGATCTGCTGTTCTATTGCCCGTCGGCCATGCGGCAGGAGGAGGACCGTGACGAGATCGCGAAGCTG
GTGGTGCCTGAGACCCTGCAACAAGATTTCCCACATCATAACCACGCAAGTCTGGAAGGGGGACATCAAGGGATCGGAAGGACGTACCGACGAATCCGAT
CACACTTCCACTGGAGGGGCTTATACCGAAGTGTTCAGCGCTATGTGGGAGAATGTACAGATTGTGAGACAGGGAAAGGCCGACCCTTCGTGAGAGGAGA
ATCCCCTGGGAACGTGCAAGCGACGTACCCGTTTCAGATCATCGCTATGGATCACATTCCGTCGTTGCCTAAGTCTGTGGTGAAGCGGGATCACGAAAAT
TGCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCT
TGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGG
AACTGGGGGTTGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGTGTCCTTGG
GTGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCCGTGTG
ATTACCTTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCACCTGGAATAAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTC
TTCTTCTCTTATTAGGTAAAACAACAAGCAAAAGCAACAATGACCTCAGCTTCCTACCTCCCCCTTTACTGGATTCTTTCACCCATCTCCCGAGGTACCT
TCCACAGATCTTTTACTCCGGAATGATTGCGGGTGTACCACCAAAGTGGTACGTCACGATCGCCATTTGCGATCGGGATCGCGATCGCAGTGGTGGCCGA
TCGCATATCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTCCATACCCCTACCCCTCAGGT
CCAATTTAATCCCTCCAAAGTCTGCCTTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAAC
ATCCACTTCACCACAATCGCCCCCTGTACATGCCGGGGCTGCCCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTATCGCTCCTCGCCACCACACC
TCCACAGCACCATGTCGGACAACTCTTCGCCGGATCAGGGGCGTTCCCCGAACGATCCTTCTTCCCACTCGCCTACGCCCGCCTCTTCCCGATCTCCTTC
ATCGCCGCAGAGGGCTACGACCTCGAATTCGTCCCGCTGTTCCTGTGGCTTCCGATGCCACCGTCACAACTCCTGCAGCTTTCTCCGAACATGTACGCCG
AATCGAAGGTCAACCTGGCGATCTCTCGACCGAGTCGTTGCCTCAAGCTGGTTCCTCGTTGCCGCCCTTAGACCAGATCACCATCCGGAGATCGTTGGCT
GCAGTTGAAGCCGCTCTGGATCGCGAGAGTGAGTTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAACGTGTGG
CAGACCTGGAGCACACAATTCGTTCGGCAGCTCAGTCGGCGTCCCCATTCGTCTGCTTCGTCCAACAGAAGTACGATCAGCTGTCCCATCGTCTCGCGCA
GTCTATCCTGGACTTAGCGGAAACCCGAGAAGCTCTGGCCCGGAGACTCGACAATGCAACCGAGCTCACCAACCTCCGTGATCGTATGCGCCTCCAAGAT
CAGTACACGCGGAAGCCGTCGCTGACTTCCAAAGGGAAATCGATGATTTGGAGCGGCGTCTAACGGCTGCATTGGCAGTTGCCAGCACGACTTCTGGTGA
CACAGCTCTGCCTCCGTCTGGGGTCAACCCGACCACCCTTCAACTCCAATCCCAGCTGAACGTGGCGATCGCAGCCCAAGGTCTAGCGAACCGCGATCTG
GATCAGGCCCGCGACTCAATTCGCGATCTCGAGACCTCCCAGAAGGCTCTCGAGGGATCGGCGCAGATCCTCCGGCAACAGGTGGCGCTACTCGAGCGTC
GTGCGTCCGAATTGCGCGACCAGTTGGCGCAACCCGACACGGTTCCCGGCGTGCCCTCGACCAGAGTCTTCAGGAACGACAACGGCTGCAGGACCTACTG
GACAAGTCCGACCAAGATCTAAGCGATCAAGCGGCGAAACTACAACGGGTGACCCAAGAACGTGATCGCGCTCGGAACGAGCTTTCACAAGCACGTACGT
AATCGCGTCGATCCTTCAGCGTCCGTTGATCTAATCCCGTTTCTCTTTCTTGCAGGTAACCAAGTCACATCCGCCCGCCTTTCCATAGCTCGGCTGGAGC
AGCGAGCAAGCAGCCTCCAGTCTTCGGTAGCCGCCAACCACCAGCTGAGCAGCACTAATGCCGTGTTGCGTGCTGACCTCGCGACCGCCCGTCAATCCCA
ACAAGATCTGGAGAGCGTGCGTGATCAGCTGATCACAGAGCGAGACGGTGCTTTGCGGCGCCTTTCGGACATCACCAGCATACTTCAACCTGGCTCGATC
GTTCCTCCGGCGACTCCTGTTCCCACGCCAGCCAGCGATCCCTCCCTGCTGAAAAAGTTCCATCACGGAAACGTCTCGCCAGCCGCTCTCCTTCCCGTCG
CTCTCCATCAAGTCCGTCGTCTCGTCGCAAGCGGCCTCACAAGTCTCGACGTCGCCGATCTCCTTCATCCGGCGACAGCGACGATGATGACGCTCTGAAC
GCCGGTCTCGCTCGATCGCGTTCGTCTGGTAGACGATCACATTTGTCCCGATCGAAGCGTCGCGCAGCAGGTACCCCAGCAAGCCGATCAACGTCGACTC
TTCTAGCGATCGTGGATCGGATGGCCAAGCCAACGACGACGGCAATAACGACGATGGCTGTAACGCCAGTGACGATGACCGCGATAACGACGATGGCGGT
AACGCCGGTGACGGCGACCACCATGACGACGATGACGGTAACGACGGCGACGGCGACCGCAATGATGACGGTAACGACGGCGATAACAAAGACAGCGACC
ACGAGGGCGACAACGACGATGGCGGCGGCGGTGACGGCGGCGGTGATGGCGGTGACTCGTCCGGAGGCAGCTCCGCCGGCGACCACCACTCGGGCGATTC
CGATAGCAGCGATTCAGCGAACTCTGTCTTGTCCGATGCCGAGCTCGATCAGCTCGATCCCACCACCATCTCTCGGGACCGTTGGATCCCAGGGTACCGG
AGTCCTGTAAGGTTCGCGGGTACGGACGTGGACCCTTGGCCTCTTTCTCCGGTTCGTCAACTCAGCGTCCGCCATTTGACGGTCGCCACGTTATTTCGTC
AGTGGAGTCGTCCGCCATCTTGGCTATTCCCGCGTCGGACCCGCACTCCTTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAATATCTTGGC
GTTGTATAAACTGCGACCATGGATTGTGTTGGGTCGGGCAGTTCCGCCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCG
GCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACAAGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTT
GGCTCGGGTGCAAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCAGACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGA
CCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAACGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACTTAATC
AACGCTCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAATATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGACGGTA
AGTTTCGGTCCATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGGTCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGG
TCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATT
CTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTT
CAAAGTCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGTGGACTCGT
CCGTAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGG
CTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGGCGCGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATC
GGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCT
TCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCCACCGCGATGTTGTGGGGCCGCAGATCTTCGTTGTGTCGGTTGGCTCT
GCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGT
CGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCCATGGGCCAGGTAGAACGGCGTGTCGCCACGAACTCGATCCTGGG
CCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTAGAGTCTGCACC
ATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAA
AACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCAGTGCGAGAGGC
GCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATG
GCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCA
CGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACGCGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGC
GTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTAC
AGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACG
ATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCG
TCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGG
TCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATAT
GTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTG
CCGGATCACTAAATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGAAACACAACACAGTCCGCGGTATTCAGCTTCGT
TCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGAC
ACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCATGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCA
ATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTA
ACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAA
GATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGGGCTTC
AGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCG
GGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATC
TTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAACCATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGG
ACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGT
TGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCACTTTTCGTCGGCCCCAGAAACTTTT