Description :
From Genome Similarity Track
Location :
contig_120:4948- 6985
Transcript NameFunction/comments
g13403.t1hypothetical protein
g13404.t1hypothetical protein

Sequence
2037 bases(100 bases per row)
AAAGGCTTGCTGAAGGATCGCCTAGTGGCGTTTTCGGGCAGCCCATGGGCGTCGCCCATCATGATTGTGCTCAAGAAGAATGGAGTTGATATTCGATTGT
GCATCGACTACAAGCTGGTAAATGCAGTTACGGCGATTATGGAGTACGCCATGCCGTTGGTTGATGACTTGTTGACCGACCTGGAAGCCTACTTATGGTT
CTGCTCGCTTGATGCGGCCAGTGGCTTCTGGGCCATTATGATGGCGATGCGAGCCGCAAGGTCTCAGCCTTCGTCTGTGCGCTCGGACACTTCGAATGGC
TTCGTATGCCGTTTGGATTGAAGAACGCACCGATGATTTACCAACGAATGATCGACAATGCTCTGTGGGGTTTTGTCCAACCCAAAGGCGGCTGGCTCCA
CTTCTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCACGGACAGGGGTGACCGACCCTTCATTGCGACAACCCGAGGATTCAACAACTCGG
CCGACCAAATTCGAGGCCGACCGAGAGTCCTCGGTCACGCTTGATGCAGTGAATCAGTTAGTGAACAGCCCTATTGCCGACATGTTCTTCGCTGGAGACC
TGGATGAATCCTTGTTGGTGCCAGTGTTCGACCGGCGATCGTTCGTCGATGATATCTGTTTTAGGTCCGAGACTTTCGACGCGTGCCTGGAGACGCTAGA
CCAACTGCTCCAACGGTTCACTGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGACTTCCTGTCGCACGAAGTCTCT
GCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCGTTCCCTGCTTCGAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGA
ATTACTACACCAGGGCTTCGCAGTGTATGGAGCAGCTCTGTATCAGTTGAAGGACGAAGACTTCACACCTAGTGACAGCCTCTCGGCGGCCAAGCGAAGC
TTCGCGGCGCTCCAACAGAAGGTTGCAGAAGCACCGATCCTCCGGCACTTTGACCGAGACAAAGAGGTGCATGTCACATTAGGCATTGAGCTCCACTTTG
ATGCAATCCCACGATGACAAGTTGCACCCGGTCCGATTTTGTGGCCGAGTCCTCAAGGACGCCAAGATGAACTACCACCCTGCCGAGAAGGAGGTCTTGG
CACTACTGCTGGTGTTGAAGGTGTGCTACTCTTAGTTGATGGGTCGGACCATCCACGTTTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAGTCTAA
GACACTGTTCGGTCGAGCGACCCATTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGTCCAGCAT
CTACAAGCCGGTCTCACAAGCTTCGTTGAATTGGAAGACTCGTTGGCCCCGGTTACACCTCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCATT
TGCTTTATGCTTGCCTACCGAGTTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGATCGAAAAGAACGGCGGGTATGGCAGTTGCTCGTG
GACTAGCCGAGCGCCGCCCGCGTTGCGGGCAGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTGCTATG
ACAGGGTTATGTTTTATATCAGTATATTTTACAGTAGACTTATACCATAACCCTAAGCCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATG
CACTGCTTGGTCCTGGGTTTTCACACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACA
ATTACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATG
TTAGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTG