Description :
From Genome Similarity Track
Location :
Scaffold_50:49478- 50642
Transcript NameFunction/comments
Hyaar_Emoy2806394hypothetical protein
Hyaar_Emoy2806395serine/threonine protein kinase

Sequence
1164 bases(100 bases per row)
ATAAAGATGGAACTTATGATGGGAAAGACTTGGACAGGAACGAGCAGGGGTTAGCGAGTGACGGGTGAGCGAAAGTTATTGGTTCATGAAGAGCGCGAGG
TGTAATGAAGCGAGTACATCTTGTGAGATTGGTCTGGTGATTGCCTAGTTTAGGATCATCTCCGTAGTGGCGTTGGCTTAATATCTGCAGTACAAAAAGC
TTCTGCTCTTGGTTAAAACCAAATGTCGGAGTCTTGGTCTCTTTCTATCTATATATTTATCAACAGTTCCTGCTTGTAACCGGTTCTCGTCCGTTCATGG
GTTTTGCTAATCTACAGACGTCAAACGCGCGCGTTCTTCTTCTCGCCAAATCTCCTACCTACCTAAATGCTTCAAAGCCGCTCAATCCGCATGCACGTCG
AGCGAGAGCTGATACACTTTCTGGGCCCGACGTGCCCGTTGAAAGTACATGACACTCGTCCCAAAGACGCACAAGTACAAGAACGACGCCAGGAAGACAC
TTGCTGCTAACGACGACTTGGGTTTGCCAGCTGGCGGTCGAACCTTAATATACAGCGAGTTGCTGGCGACCATGCAGCCCACGATAAACTACCACAAAAA
CACAGAAAAAAGAAGCACAAAGCACACAAAAGTCTCATATCCCGTAAGTTACTTGATCCATGATTAAAATCTTCATAGAAAACACCACCAACACAACAAG
ATCAAAAAAGAACCACTACCACATCTTACGACGTACAAGCAAAAAGAAGCCAGTAAATGAAAGAATCGCACACCAAATTATCCCTACCCAAGTATTGAAA
ACCCCACAAAAACACAAAAAAAGACACACAAAAAACATCCATTAGTCCAGCCTATTTTTCATCAATGGTGCAATCATTTACAACCAACGCACTCGCCCTC
ATAACTCCCGCTAGACGAGACGTACCCGGATGTGTCTGTGGTCCCTGACTCGATCCCATTGCCAGCAGCTCGTCCAGATCTGTCGCTTCTCCAAGATCAC
TGACGTCACTCGGAGGTGACCCCACATGCAGGTGCTTGAGGTTCGCGTATTCGGCCGCTTTGCCGCCAGTAACGACCGCCACCATGTCTTTACGATCAAA
TGTTGCCGTCATTTCCTTGCGCAAGTCTCCGTAAACATCCTTCAAGCGCGACATATGGAGGGAC