Description :
From Genome Similarity Track
Location :
Scaffold_96:49477- 51670
Transcript NameFunction/comments
Phyke_g6352hypothetical protein PHYSODRAFT_296145

Sequence
2193 bases(100 bases per row)
CACACAGTAAATAGTAGCCAGTAACAGTACCTCGGCGGTACCTCTCGTGTCACGCTCACGGTGGCACCTAGCATACAATGGCTATGACAGACGCTTTTCG
ATGAGCAAAGTCGAACAATAGCGAAATCCATCCTTGGGAGAATGCGAGCAAGATGGAGAGCCAGTGCTCACCCTCACTACCTTTTTGCAGACTCCTTTGT
AGCAGCATCCTTGTCAGCTTGCATTAGAACGTCCTTGTTCGTTAGACGCCCGCTGCGCACCAAGTCATCGCGAGCACCAAGGGGTTTTCTCTGACTCCAC
GTCTTCTTTCCTGTTTGAGGGGGATCGGGAGCATCGTCAGAAAAAATCTGAAAAACTTGTTTGGGAAAGGCTTCGTTTGGATCTTGGCGCAGCGACTGGT
CTTGTGCATTCATTGCAACGCTGTCCACCGAATCGTCAAACACGCTGAACTGGAGCTTTCTTTCAACCGGGTCCTCATCTTTTGTATCCCAAGCGCTCGG
TTTGGGCTGCCTCGGGGGACTACAAAACATGCCGTTGATGTCTTCCAGCGCAACACGAGTATTAATCGTCATATCTTCTTGGTCATCGTGCTGCATGTCG
GCCAACTTACTCGAAGAAATAACGGCAGTCGCGGCGGACTTTTGTTCTGCTGGCTTCATTTCACGTGGTGTATTTACCATCGTATTTGAAGCGGCAACGT
CCGCAGTTGCCACTTGAAAAGTAGCGTTGCCATCCATGAACGTGTTTCGTAGCGCCCGGCTATCAAGCTTGCGACGTCTATCGACGGCTCGTTTGTATGC
ACGAGCACGAACTTCTTCAAAGGATAGAGCTTCACCTGTATCGGAAGTAAGTGGTTTTGCATCATAACAGGGTTTTTCCAACCTGGTATCCGCCTTGTGC
TTTTGTCTCTTTGCGTCTTCCCGAGCTTTTTTGTCGCTAGCCGTGAAATTCTTCAGCGGCTCTTGCGCGAGCATTTCTTCCTCCGTGGCTATGCCCTCCA
CTCGCTGTCGAAGTGTCAGAGAACGATTTGTCAGATGCGCGGGTCGTTTGGTTTCGTGGTCAGGCATAGAAAACTCATCGTCCACGAAGACCTGGAGAGG
GCTCGACTCTGGAGGCCCATTAGACCCGGGCGGTGGGTGGCGATCTGCGAGACGCCCAGGTTCAGTCGCATTTCGCGCAACAGGCGGATTCCACGTTGTT
GGCGCAAGGACATTCTCCTtgttctgttgctgcacgGTGTCGAGCTTTTTCCAGCCACCATTACCGTCAAAAGGATCGACAGCGTGTCTAACAGGGTCCT
CATAAATAGTAAATACCGGTTTGTGCGCATTCGCTCGCTGGACACGCTCCGAACGGACAaaagcttgctgctgctggagttgctgccgttgtGCATCACT
GAGATCTAGCGTACCATGTGACGGCAGGTTCTCAAGTGCACGACGATAATTTACCTTGTCAGCGTCATTGGTAGACTCTGCAgtcatcttcagccactGT
CGACTCATTCGACGCTGGAACTCCTTGTACTTTCTCTCCAAGAGATCCTGCGGTTCTGCattcctgcagcacaatCAGCAGTTGTAGTCTTGTTAGCACT
ACACTCATTAATAAGAATAGAGCGCTGTACACTTGTTCACATCACATACTTCTGGCTGGCTTTTAAATAAATCTTGTGCGCCTGTGGGTAGTTGGCCATA
GTCTCCAGCACGTAAGCCCAGCCAATGTAGAATAGTGACACACACTCGCCGATCTTGTTCTGGTACAAATACTTAAAGATATCCTTGGGGTTGGACACCA
AATCCGCCTGAATAGCAATCCACAACAACGGCTTCATGTTAGCATCTGACCAACGACCTAAGCAACAAGAACCCTCCTCCTACTTACGTATTGGATCCAG
AGACGGATGTAGCGCATGTCGTTGTGGTAGCGTGGGTTGTCCTTGAGAGCGCGTGTGCATTGCTCCAGGACTGTGAACTTCTTCCTCGTGTCTTCAGGCA
TTTTGACttcgagccaccgcacgtACTCGACCCAGTCAGCGAGCGGATCGTCTCCGTCGTACGCCTTGATGGCGTCTTCTTTGGCCTTCACTTCGTCGTC
CAACCGCATCTTCGTCTGGAACGAGTCATGCGCACGCAGCGCCTTGTTAAGATCGGACACGTTCCGACCGCGCTTGAGCGGTATAACGTTCTC