Description :
From Genome Similarity Track
Location :
contig_61:49476- 50914
Transcript NameFunction/comments
g11331.t1hypothetical protein
g11332.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
GCCTGTGAGGTACAGCCGCGACACCACGGGGATCTCGTAGTACCATTCCAGCGGATCGTTCATGCTCGTCGACGTCCTCTTCCTCAAGTCTTTACGAAAT
GATGACACTTGGCATTATAGCGGCCCGCGGGCCTGTTTTGTCAAAACCCGCGGGTCGGTCGCCGGTCTTTGTCAGAAGTTGAAGTGACCACCACTCTGGC
ATTCCGCGTTAGACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACGAAGGTGTCGGAGGACGTGGCAGCGCGCA
TCGAGCTGACGCTGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGCTACACGCCTCTTTCCTGGGGCTAAATGA
GTGAGTCTTAACGATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGGATCCTTGCAGACCTGCAGCTGTGGCACG
GCCGACATTTGCATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTGTGGCAGAAGTCGCTCATTGATTCAGAGG
TGTGTGGTGTGTGTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGTGCTGTGGCTGCAGATTGAGATGCTGCTC
CGAGGAGGATACAAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAACAGAAGGAAGAAGCGGCGACTGCGCAACCTGAAGATGCAGACGTGA
ATAGGCACGATCTGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACTTTTTGCCGCAAAGGGTGAGTGGTCCT
TGCATTAATTGGTGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGCATGAAAGTCTTTGGCGAAAGTCGGAG
GCAGTCGAAAGAAAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAAAAGAGATGGATGCAGCGAATAGAGCT
CCCAATGTTCATAAAGGTGCGTCGTGCAGGAAATGCAAAACAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTTCAATGCAAGAATGTGGATTTGTGCG
CTCGATGCTTCAAGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTCCAGCTTTGCGTGACAACCAGCCCCG
AACAGCAATCAGCTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCTGCAGCTGGACCAAGGAGGCAAGCAC
CCTATTCAAGACTACCTCGTGAAAGTGCTGCCAGGCAC