Description :
From Genome Similarity Track
Location :
Scaffold_40:494516- 495935
Sequence
1419 bases(100 bases per row)
AGAACGGAACGTGGACGTTGGTTCCATGTGGAACGGCTACGCGCTCCATTGGATGTCGCTGGGTGTTCACCAAGAAGCGTGGCGAGAACGGTCGTGTTAT
CCGTTACAAGGCACGCCTAGTAGCTCAAGGGTTCAAGCAGAAGTTTGGAATCGATTTTTTTGAGACGTATTCTCCTGTTGCAAACATGAACTCGATTCGG
GTTGTACTCGCTGTGTGTGTGTGGCATGCGACTACATTATGGAGCAACTGGATGCTGACACAGCGTTCCTAAACAGTGGTTTGGTGGATTTGGCCTACAT
GGACGTTCCACTTGGTCTCGAGAACGCTGAAGGCATGAAGTGCAAGCTGCTAAAGGCCATATATGGTTTGAAGCAAGCTGCAAGTGCATGGAACTAGACT
ATCTATCGTGTGTTCCTGCGGAACGGTTTCAAGAGTTGTGGAGCCGACCAGTGTGTCTACGTCAAGCGTTCCAGGGACGCATTCGTGTACGTGTGCCTGT
ATGTGGACGACATGATCATTGCGGCGAAGACACCCGAAGCGATTCGCGAAGTAAAGGGCGCTCTGAAGAGTGCCTTCAAGATGAAAGAGCTTGGCGAGGC
AAAGTTCATCCTGGGGATGGAGATTGATCATGATAAGGCAGCTGGAACGCTGATGATCAAGCAAACTCGGTACATTGACGACATTGTAGAACGCTTCAAC
CAACGGAACGCCAATATGTTGGATAACCCATGCGCGTCAAACATGAAGCTGTCGAAGATGATGTCGCCAGCCACGGAGAAGGAACGACGTGAAATGCAGT
CAAGACCGTACCGTTCCTTGATCGGATGCCTGATGTACATCACAACATGCACTCGACCGGACATTGCGTACGTTGTAACGCAGTTGTCACGCTTCCTGGA
GAATCCTGGAACGCAACACTGGAAGGCAGCGATACGGGTCCTGCAGTACTTGAAGACAACTCGGCAGCACGGTATCGTCTACCAAAGTGGAACGCAAGGT
GTCAAGGCAGAGGCGTTCACGGACGCAGACTGGGGAAGCAACATTGACGACAGGCGTTCCGTATCAGGTGTCATGGTCATAATTGGGAACGCTCCGGTTG
TGTTCAAGTCCAAGTACCAGAGAACGGCTGCGCTCAGCTCAGCGGAAGCAGAGTACATGGCTCTGAGTCTGTGTACGCAAGAGTTACTGTGGACACGTGC
TATTCTCAAGGACATGGGTCACGAGCAAGTGGGAGCGACGCAGGTCTGGGAGGACAATCAAGGTGCTATCGCACTTGCAAGTAACGCTGGGTATCACGCT
AGGACCAAGCACGTGGGTATCCGACATCACTTCATTCGAGAGAATGTGAAACGCTCTACGATCAAGGTGGACTACGTCGACACGAAGCGCCAATTTGCGG
ACAAGCTGACGAAGGCGCT