Description :
From Genome Similarity Track
Location :
Scaffold_309:4945- 9409
Transcript NameFunction/comments
Phypl_g6782hypothetical protein
Phypl_g6783nardilysin, putative

Sequence
4464 bases(100 bases per row)
gacgactttgtgtgttctgcaataccacatCAGCGTCTGTCGGAACTTTGTAGCGGATCTGTGGGATCCTGCCAAGCGCCTTGCACACTCATCCCCACTT
GTCCCTGAACGTTTGCTTGGGCACAGGGTGGCCTCCAGCGCGAATTACGCGCCTCCAGACGTCGTTGCACGTTTCGTCGGACGTCATCCGCGGCAGAAAC
ACGTACACCCGTGCGGTGAGTGCCTCGACTGAGTTGTGAGGCTCAGTCGGACGCCCAGGGGGTTTCGGCGCATCAGTCTTGCTAGAGTGGAGGCTGTCGA
GGATGAGCCGTGCGCACGGTTGTCTTGCCCCACCCGGTCTTcgccgcgacggccgcgtAGTCGTACGTGAACCGTTGATAGTGCGGAAGCCACTTGGTGT
GCTGTATGAGCAGGACCATGAGGCAAACGGAGTCCGCGGCAGTCAGGGAGAGCCCGCGcggcctgcgcctccttggACTTGGTCATGCGGATTCGGTGTG
AGCCAGGTGCGCTAGACTGCCAGTCTGGCGCACCATGCCGACCTTGAAGTGATCCAGACCAAGCGAGCAGACATATCATGGCCTGGTGCCAGCATCTCGT
TCGCCACGTACGCGCAAGCCTCCAACACAGCGTATGCGACCGCGGGAATGGGAACTGGAAATGGGCGGGGCCCAATTAAAGTGGGGCTTCCGTTCGCCTT
TTAGTTTAGTCGGAACGGGTGTTATCCGTGGTGGACATAATTCCGGTCAGGACATAATTCCGGTCACCTGCCTCACATACAAATCTAAGTCAAAACGGAA
AAGGTGACCCTGATTTGTGCCGCCAATAACGACGTAAAAACAGCCTCTGCCGGCCTGTTTGGGGCATCAAAACGAATGGCGGGAAACTCCTCTTTCAAAT
AAGGTGCTGCATTGTTGGTTTTACTCGTGGTTATTGAAGGTATCCGTCGACGGTCACTACTGCTGGAGCGGGAGATGCAATTTCAGCCCCACTGCGGTAC
ACTTCAACGCTGAGCTAAATACAGAAGTCCGCGCGCTCGAAGGTATGTTCAGAATGAGGTGAACTCTGGTCATTCCAACCACTGTATTATGTGTTGTTTG
TTGTGCAGTGGGGGATGCGGACAAGTTCCTGGACGCCTTCTTCTTTGACACCTTCGTCAACGTGGACACTGACCGGACGACCAAATCCGTCTTGGTCGAT
GAAAGCAAGGTGGTGAAGATCAAACTTTCGATTATTCACCTCCATGAAGAAAAGCTCAAGAAAGCCACCGAAAgggccaagaagaaggccgatGAGGCTG
CGGGGGTGACTGTGACTGCAGGAAAACGCAAACAGGGGGATGCCAGTCGTTTTCAGAGTCAGTGAGTGTTAGTTGTTAGTTTAGTTGTATGCCTTTAGTT
GCTATGCCGATCACATAATACAAGTAGATCGACTTCAAAGAAAAACACATTGGTTTCGTCCATTCGATCAGCGAACTCCTTCACTTGGTTTCAGTATACT
TCCTTGGGTTTTGCAGCTGGTTTGCTGCTCACAATCCGATGGCGGACCCCGTGGAGGCTTCCAAGTCGCCCAATGACCAGAAGAAGTACcggctgctgac
gctgcccaacgcgctgcaggcgctgctcatcTCCACagcggaggtggcgcacgtggtggaggccgtggcgcgcgagagcgagagcgcgGGCCGCGACGAG
GATGAGGACATGGACGACCAGAATCTTAGCGGAGaggacagcgccagcgacttgagcgagagcgaggacgacggcagcagcttcggcgacagcgacgagg
agctcgagggcgcgcccagccgccgcgccgGCGCCTGCCTCACCGTGGGCGTGGGCAGCTTCGCGGAGCCCGAGGCGCTCCCCGGCCTGGCGCACTACCT
GGAGCACATGCTGTTCATGGGCAGCGACAAGTACCcggacgagaacgagttcgaggccTTTCTGAGCGCCCACGGGGGCTACAGCAACGGCGCCACGGAC
AACGAGGTGACCAGCTACACGTTCGAGGTGGGGCCGGCGCACCTGGAGCCAGCGCTCGACATGTTCGCgcacttcttcatctcgccaCTGCTCAAGGCTG
AGGCCATGGAGAGGGAGCTGTCGGCTATTGAGTCCGAGTTCAGTCAGGCTACCCAGAACGACCGGATCCGctcgcagcaggtgctgtGCGACGTGACGCC
TCCGAGCCACCCGTACCACCGCTTCAGCTGGGGCAACAAGAAGAgtctgcaggagctgccggGGAAGACGGGCGTCGACGTGCGCAAGCAGATCCTGCAG
TTCTACGAGAAGTACTACTCGGCCAGCATCATGAAGCTTGTTGTTTGCGGGGAAAACACGCTGGATGAGTTGGAGCAGTGGGTGACCAAGTCGTTCAGCT
CGATTCCGAACAAGCAGGTGGAGGTGCCGTCTTTCGCGTTGGCGGGGCCGCCCTTTGGAGCGAAAGGTTCTGGTGCACCGTTCCTCTGCAAGATTTCCCC
TGTCCGGGACATCCACACGCTTCATCTCGACTGGATGATCCCGCCCGTTCTTGGTCAACATCACCAGAAACCCGCGGACTACATCGCTAGCCTCCTTGGT
CATGAAAGCGAAGGATCTGTGCTCTCCCATGTATGCCAACCAACTTGATTCTTGTCGAATTGCCAGTTTTGTTGAGAACTAATACTCACGGTGCATGTTG
AATGTattgcagctgaaggagcggGGCTGGATCTCTGCGGTGACCGCAGGGGTAACCGACACTGATGGCTATGACTGTGGTACCTATGCAGCGAAGTTTG
ATATCACGATGAAACTCACGCTGGAGGGCATTTCCCACTGGGAGGAAATTGTGCACGCAGTTTTTGAGTACCTGCACATGCTCAGGGTAAATGGATGCCC
GGAGTGGGTGTttgacgagctggcggcacTGGCCGACATTTCGTTCCGCTTCCAGGAAGAGGATAGTGCTGTCGAAAGGTGTGAAGAGCTGGGAGAAATT
ATGCAGGTAAGCACTCTTGCTACACCAGTTGCAAGATGTTTTTcttttgttgttgttttgAACTAACCATTTTTAAATGCATACAGTTGATGTTCAAGGT
CGCACCGGAGGATATTTTGCGCTACGACCTGTTCCAGGGTGCCTTCCAGAAGGAGCTTGCTGAAGAAGTGCTGAGTCACTTGGCCGCTGAGTCTGTGTGC
GTCTCGATCGTTTCGCAGAAGTTTGAAGAATCCCCTGAATTTCAGGCACAGGTGTGTAATGATACGATGGTCTCTGCTGATTCAACCTCTTTGAAATTGC
TAACCCGTTATGTTTCGTCTTGTTTTATGGTAATAATAGGCCCTTGAGGAGGAGTGGTTTGGAGTCAAGTACTCGCGAGAGAATATTACGGACATCACTA
TtcagcgctggaagagcgcaGGAGCTAACCCCAAGCTGCACCTGCCGCGTCCAAACCAGTTTATTCCGCGAGATTTCTCGCTCGTGGATTCAACAGGTGT
TAAGGACCTTGTGTGCGAAAAGACGGCGTTCGGCAAGCTATGGTACAAGCCAGATCGTGTATTTGCTACTCCTCGCGCTCACGTTGCGCTTTTGGTGCAC
TTGCCCAGTGTGGTAGCTAACGTGGACAATTGGGCCCACACCCAGCTGTACGTGAAGCTTGTTCGGGATGCGCTTAATGAGTACGCATACCATGCGAATG
TGGCCGAGCTCATGTACTCGCTTCATGTCAAGGAGTCTGGTCTGGAATTGATCTTTGGTGGTTTCAACGATaagctccaccttcttgtcgAAGTGGTGGT
CGCGGCTGTGTTTGGAACGGAAGTCAATGAAGCACGTTTTGAAGTGATGCGAGAAGAATTGATGCGCGAATCGAAGAACGCAATCACGAAGGTGGCACAA
AAAGCGAAGTACCTTCGGTTGCAACTTCTGGAGAAGAACTCGTTTCCGCTGGAGGAACGCTTGGACTCGATCGAGGCTGCCACCGTAGGATCACTCAAAA
AGTACGTCTCAAGCCAACTCTGGGCAAACAAGGCATGGCTTGCCAGTTTTGCGCACGGAAATATTTcccatgcagcagcgtcgcaAATGATCGCCAATGT
CgaagcgcagctgcagcgtgtggctGCACCGCTACAGTTGCGAGACTTTCCCCGACGCCTTATCAATGCCATCCCGCAGACCCCCATGGGCTTTCTGCTG
AAGGAGCGCAGCGCAAACAAAACTGAGACGAACACACAGGTGGAACTCTACTACCAGATCGGTCCGTTGACTCTGCGTAGCCTGGCCTACGCGGACTTGT
TGCACCAGTTGATGGAGGAACCATTATTTGACACTTTACGCACGAAGCAGGAGCTCGGTTACGATGTCTCTTGCACTGTTCGTGTGACCAACGGCATTTT
GGGCTTCGGTGTCATGGTTCAGTCGTCATTGTTCGCAGCGGAGTACATTTCTGCTTGCGTTGAC