Description :
From Genome Similarity Track
Location :
Scaffold_161:49435- 52329
Transcript NameFunction/comments
Phyra_85308KRAB-A domain-containing protein

Sequence
2894 bases(100 bases per row)
CGAGAAGCGAGGAGCACACGTGGGGGATTTTCCGTGAGCATGTGCTCCAACACTTCGAAGCGTCGAACTACCAAGCCGTCCTGCGCGAGAAGCTTCAGCG
CCTCAAGCAAACGGCGGACATCGAGACCTACAATGGCGAGTATTCAGCTCTCATCTTCCGGGTGGAAGGCATGAGCATACTCGACCAAGTGCTGTGCTAC
GCGAACGGTCTCAACCCTAGCACGCGCAGCTACGTCAAGCTCGAGAACCCTGTCACGCTGAGTGACGCTATGGACTTAGCCGTCAAGTATGAGGTGACCC
ACTTCGTTGAAGAAGTGCGCGAGCATCGACATGAACGAGACAAGTGATTGTCGTCAGCTGGCCAGATCCAAGACCGTGGCAAACCGTTCAAGGGGAAGTC
GTTTCGCCAGAAGGGTCGTTTCAAGCCGAAGGCGGAGAACAAGCGCACTGAAGATCGTACCTGCTTCTTCTGTAAGAAGCCAGGTCACGTGAAGGCCAAC
TGCTACGCGTGGAAGAAGGAACAAGCCAAGCAGGGAAACGAGCAACCACGTCAGTGAATGAGGGTCCTGGCGTGGGCGCGAGTGTAACCAGAACGACTAA
GATTGAGAATACCAGCCTCATCGTTCTGAGTGAAAATCCTCTTGTCTACAAATCTCGGCCGCTGTTCTCCGTTTCCGGAGAGATACACGTGGCCGCCAAG
AACATTGCGACGCGAAATGTGTTACTGGGCTGCGGAGCAACCACGATTTATGTGTCGAGCCGATGGGTCACGGAGCAGCAGCTCCAGACGACGAAGTTCA
GTGACAAGAATATCCGCGTCAAGCTTGGAGATAACCAAATCGTGGAAGCGGAACTGGAAGTTCTGCCTCTCGAGATCCATGCGTCAGGGCTAGACGAGGC
GTACACGTGTGTCGCTGTGGTCTACGCAATACCTGACGAATTTGACTGCATCCTCGGAATTCCATTCTTCGAGGACGTGCAGCCCCAAATCGACTGGAGA
GGTCGACGTATTCAAGGAACAGAAGTGAAGACTCTGCACTGGAAGCGGTCAGGTGCTACCTGTGGACCGATTGAGGAAGGCGAACCGGTGATTGCCTCCG
GGCTTCGGAGATCTGTCGAAGCAAAAAGACCCGATTCCTGTCTAGGCGCCGCGCTGGAAACGGATGTGAAGTCTGTGGATGGTCCAGATCGCGATTTAGT
GCAGAATGAGACCCCAAGTGTTGTCTGCGGACAGCAAGAAGATGCGTCAACCGGCAAGGGTCCGGTAGAAGAGCGCGACGTGGAGTCGCCGAGACGCGAG
GGTGCTGCCGAAGTGGCTCAAGAGAGCAGCAGTGCCCAGGGGAAGAGCACCGTTGTGGAAAAGATGTTCACCATTGGTGTTGTTAATGAGGTTGGTGTGG
AAACCAAGTACATCACGCGTAAGAAATTGCGCAAGTTCCTCCGAATCAAGACCAAGTCGATCGACGAACCGGACTTCATGCTGGTTCTGACGAACGAGAC
GATCAAGCAAGTTGCTCGATCACTTCAACGGCGAGACCATCCTGACAATGTCGGAAGCGCGAAAGCCCAACGATATCTAGAGACGGACTGGGATAGCTTC
AAGGACAATCCTGCGTTCCAGTTATTCGTGGAATACAAGGACAGTGTGTTCCGACCTGCTTCAAGAAGGCTTGCCCGAGAAGCGTGACATCGAGCATCGG
ATTGACGTGAAAGATCCAAATCTGGCAATGTACCGGCAGCAGTGAAGACAATCACCAGAACAGCAGCGCGAGATCGTGCGCTGGGTCGAGGATATGGTTA
GAAAGAAGCTCATCCGTCCAAGCATCAGTCCACACGCAGCACCAACTTTCTGTGTTTGCAAGCCAGTCGGATGGAGAATTATTCTACTTGAACTCGAACA
CGGTGCGCCAGAGTATTCCAATGACACGAAAGGAAGACATCCTGGACACCATGTCGGGTGCTTACTGGTTCTCGACCATGGACCTGATGTCCGCGTACTA
CCAAGTTCGCATGCGCGAAGAAGACATCAAGTACACAGCGTTTCAGGCTCCCAGTGGACTCTGGTAGTTCCTGGTACTACCCATGGGAGTCGGCAACGCG
CCGGCGACCATGCATCGATTGACATCGAAGCTGTTTCGTGGCTTGAAGAACACGAAATCGTTCTGCGATGACATCTACATCTTCACGAAGTCCCGCAGCA
TTGAAGAACACCTTGAAGCGTTGCGGAAAACCTTGGACATTTTGCGCGACAACAGGCTTTACGTGAAGCTTGCCAAGTGTGTTTTCTGTGCTGTAGAGAT
CCCGTGCTTAGGTGACTTCGTTGGACGAGATGGAGTTCGGATGGACCCCGACAAGATCCAGACGATTAAAGACTGGCCAGTGCCTCGAACGCAGGAGGAG
CTTCACAGCTTCCTCGGGTTGACGGGATACGTCCAGCGATTCTGCCCAGAGTACGCTTCGCTAACTGCAACCATGTTCGCTCTACTGAAAAAGCAGAACA
AGCGCAACGCGAGGACCCACTTCAACCATGAGCAATTGAAGAACTTCACGGAGTTGAAGCGTCGGTTGTGTAATCCACCGGTACTGCACCTCCCCGACTT
CAACAAACCTATGCATCTTCGAGCGGACGCGAGCAAATTTGCTGTTGGTGGAGTTCTCTTCCAGGTTGTTGATGGTGCTGAGCGTCCGATCGCGTACACC
AGTCGGAAGATGAAGTCAGCAGAGCTGAACTATCCCACGCAGCAGCAGGAGTTACTTGCTATTGTTCACGCTCTGGCCGCATTCAGAATCTAATGCCTGG
ACAAGCCTCCGATTGTCGAGACAGATCATAAAAGTCTCGAAGGTCTGTTCACGCAGAAGATGGCGAACCGTCGTCTAGCTCGCTGGTATGACAT