Description :
From Genome Similarity Track
Location :
Scaffold_96:49434- 51558
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.32DNA primase

Sequence
2124 bases(100 bases per row)
CAGGAGTGGTAGTAGTTGGCAATACGACAGCAACATCGTTGAAGAGCATCTGGATGGCGCGGATTTCGCCGTGGATGCCGCCGATGCTCGCCTTGGAGAG
GATGAACGCGTCGAGCTTCGGGAACATGGACTGTCTGCACTCGACGGATCGCGCGCTCGAGAGCCGGGAGGGATGATGATGCCCGCCGCCAGCGTTCATC
GCCCAGAGAGACTGTCTGCCGTCGCTACTGCGCTTCAAAGCGGGTGCATCCTGATCACATCGCAAGAGCCTCACTGTCTTGTATGAGCTCGTCATCAGTG
CTTCGCGAGTCGGACATGGACACACGAGCGCTCGGAAGAAAAGCTCACGGTCGAGCTGTGCGTCCTCTATACCATTTGTATGCTGTTGTTGTTGGTTGCT
CTCTTTGGTTGGAGATATGTATTGCAAGATCGCATCTCGACGATACTTAGACGAGCCGAGCACGCGGAACATGCGGTTGCGCGTGTACACCCCCGTGTCG
ATGAACAATTGCTTGTCTGCGCAGTTGTTGTTGTTGCTGTTTGTACTCTGCTGGCCATCATCCTGTGGTTGTTGCTGTCGACCACTGTTGACGAGAAACG
GGGAGTCCTGGTCATCTGCTTCGTTCGTATTCTCAACCAGATCGTGGATGAACTCGCGGACGAACTGTAGGAGTTGTTGGTATTTGATAGAAACAGAGAA
TACATCAGTATGGAAGCTCTCACTATCTCTCTCATACATGAACGAACACGCATGTTGAGAAATGAATGGGTAACGAGCGTACATTGCCTGCATGGATGTT
GTCCTCGAAGAGCTCGCCGTTGGGGAAATGGAACTGACTCAGAGAAAGTCACATCCACCACATGATAAGCAAAGTGTCTAATGAGTCTACAGGAGCCAAA
GTCTCCACACACAAGAGCTCAATGAATAATGACAGGAACGTACTATCAGATGACGGCTGAACTTGGCGCTCGTGGAGGAGTCGAGATGGACGATTTGGTC
GCGAGGCGCGTAGATCTGATACTTTCGCTAACAGTCAAACAACAAAGTCGCCAAGCCAAATATTAGCTATTCACACACACATGCACACACGCACCCCCAT
GGAATCAAACAACGAAGGCAGCAAGCACACTTACAAAGAGCTGGAGCTGCAAGAGCGAGATGAGCCTCGTCACGAGCTGGTCACCATCAACGTTTGGGTT
GCAGCTCTTCTTGAATTCTGTCATTTGTTATCGCCATCATTATCAAAGCAAAGTAGCATCGGTAAGAGCAAAAGATCAGTGAGTCCATCAATCAGCACAT
ACCATCTGTGCACATCACTAAAAAAGCAACCTTACCTAGGTCAAAGTACAGGCGGCACGGCACACCCTCGCGGATTATTTCGTACACGTGGCGCTGCGCT
GGGTGGGTGTTGACGTAGTTCTCCCAGAAAATTGCAGAGTTGCTCACGAGGAAGCGCCGTTTACCCTCGCGTGCGTCTTCAAACGAGAACACGCGCGGGA
ATTCCAAACTAGAGCTGGTTTTAATATCGCTGTCACTGTCGATCTTCGAGCTGCGGTCACGCATCATTTGCTGGCGGAAGGCCCTAATTTGGTCGACGAA
CTCAAAGGCTTCTTGCTGTCGCGGGAACGTGGACGACACTGGCGCGGTGCCCTCCAGTTGACACATCAGCGAGTGCGAGACGCGAAACTGGAGCTTCTCA
TAGAAGCTTCGCCACCCCGACTCGGATTCCAGTGGTGTCGATGAATTTGATGTTGAGCTCTGTGATATTGTCGTTGCAGGAGTTGAAGGCTTTGGGTTAT
TCCCGTAGAAATTGGTCGCCGAGAGTGTCCTCCTGCGCTTCAGGATCACAGAAGAACCGGGACGTCCTTGCCGCTGTGGGATTGGCTTCTTTGTAGTAGC
AGCGGTGGTGATTTTTGACGAGCTACCCAAAGCAGCACTGGATAGAAGCTCTCGTGCACTTGGAGATAGAGGCACTTCTGGAAAACTTTTGTGTAGATCC
GCGAGCAGCTCCGTCACAAAGTCGACGTTTCGGACAAAGCTCCACGCCTCTTCACCTGGCCTCTCTTGGTCGTTGGCGTGCAGAAGATCGATGCAACGTT
GTGCTTTGCCAAAGAAGTAGCATT