Description :
From Genome Similarity Track
Location :
Scaffold_43:49420- 50886
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14405hypothetical protein

Sequence
1466 bases(100 bases per row)
GCCTCAAGACTCATGCGCTTCAACACGCTCGCGCCAGCCAAAATGTAAGCATGCGGGTTCCAAGACTGAGCACGAATCAGCTTCTGAGCATCCATGCACA
ACCCGTTCGTCCCTGCTGGACCAGCCTTGAATAGACCCACCAGCGCATCGAGGAAGTTGCGATCCATCATCTCTTTACCTAAAGACGGCATTTGTCTGGC
ACTCGAACGCAAGTATTCCGCGAGGCAACTTGACGCCTGAAGGGCCTCCGAATCCATCGCTGCAAGAGCCAGTCGCGTCCACAAAGTGCTGGATTTAGTG
CCATCGTTAGCTTGCGACAGTGCCTGCAAGCGTGTCAAATAAGTGTCTTCGGCGCCCACCCATCGTTCATGAAGCTCAACCAAACGCAGATTCAGGTAGT
CGCGCGTGGTAAGAGTTGACTCCGCTTCATCAATCGACAACAGGAGGCGTTTCTTACACGCTGCAGCGAGACCAGTGGCCTGAGACGTGAATTGCTCCAT
CAACAAGCTCGCCAACGATAGTCCCACAAGGGCAACGACTTCACTTTGGCTGGACTGGGTTTCGTCTTGCGCCAACAGCGCCTGAAGCAGATTCAGCGCC
TCACCTCCCTTCGCTTGGCGGTATAGTACCTGGGCTTGCACGATAGCCTGTAGTGCCGAGGCTTCACTTGACGATGAGTTTATCTGTGCAACAATCTTCT
GCAGGAGTGTTGATTCTTCCTCTGTAGTGTACTTAAGTGTACTGGACAGCTCGCCGAGTTTTGTCACCAACGTGTTCCATTCAAGTCCCTCAGGCGCTTG
CGTCGACGAAGCCGCGCGGGTGTACGATGCCAAAGCCTCGGTGTAGAGTCCTAGTCGATGTTGAGCGACACCGAGGGCATGCCAAGCGCGCCCGTTGAAC
GGATCTCGTTCCAGATACTTTTTGAGATAGAACATCACCACTTCATTGCTGTGCTCTGGGGCTTGGGTGATTGATTCACCAACGCTCGCACCGAAATCAA
GCAGTGCCATGCTCAAGCCTAGCAAAGCATCCAGATCCAGCCCGGTCTGCAACGCGCAGTCGAACGCTTCAATCGCTTTTCTTTGCTGAACTGTCGAGTT
AGCTTGACGACGAGCCAGCATAGCATAGCCATTCCACATGGACGGGTTGCTTGGGTTCATGCTCTGCAGTTGGAGGAACGACTTCTGCGCCAAAGACGCT
GTTGTTGGCACGGTGTCAGCCTGACTGAGGTAGAACATACCCAGATTGGCCCATGTGGCGTCGCTGCTGGTGCCAGTTTGGATCGCTCGTGTCCAGGCAA
ATTGCTTTACCAGCAGATTATCAGACACAAGAGCCAAACCATTCCAGGCCAACGAACACGAAGGGTCCTCTTGCAGAGCCAGCTTGAAATTCGTCGATGC
CTTCACCTTCAGTGCTGCAACAGAAGAATCTGTGTCGAGTCCTGTCTCACCTGAGAAAGCTGAAGT