Description :
From Genome Similarity Track
Location :
Scaffold_359:4942- 7283
Transcript NameFunction/comments
Phyke_g8771conserved hypothetical protein
Phyke_g8772hypothetical protein PHYSODRAFT_550322

Sequence
2341 bases(100 bases per row)
TGGAATCAAGCAAGCCCGAAACTACACTGCCAAATGGATGCGTGAAAATAAAATCAACGCTTCATTCACGTTGGAAGCTCACGGCGGAGGAGATGATGCA
TACGTGACAATCACTAAAACACGTACATGGTTTTCTCAGCGTCAGCAGACTTTGAAACACTACAAGGTGGAGCTGTAGCTTCTGGAAGAATGCTACAGCG
GAGACACTACTACCTCTGATGGGACACTCGCTTGAACTGAGCCCAATGTGGATTTATTTGTCTTTGATCATTTACACAATCCGTATTGGATTGCTACCGT
TTGGAAATGAGGTAGACCCGTGGTAAGGTGCGTATCCAAGATCACTAAGCCTTCATTGACAATTATCGCTGAGGTGATTCTAGGCACAAAGCGCCACAGT
CACTAGCTTTCATTTGCTTTGAGATAACGTCGATTGCCGATCAAGGTAGTAAAAGTAAGTAAGTTGCAAGCTATCAATACTCCACCTACTGTTCATTCAC
CCTCTATTCTTGCCAAAGTCAAATTCATCACGGAAAATATAGCTTCGTGCTGTGCGACGGTCCGTGAAACGACAGCAAGTCCTTGCGCTGTCCCGCGTCT
GTGCATCTTGGCCGCTTTTGGGAGTAGACATCGCTGTTCATCCCGTTGAAGACATTGTCGACGAGGTGCACAGCTCCTTCCATACGAACACAACGAAGAA
GGACTTCATACCGTGCCAACAGATTAAGCGGGGTGTCTGCACCAGCTAAACACCTAGCAGGAGACCACTTTTGTCCAGGTGAACAAAGATTTCGCTACCG
TTTCTCCGACCCCGGAATACTGTGAGTCTGCCTTCTGAAATGGACGACTCGGCCGTGCCGCGCAACCCTCCACCCAAGCCCAAACGGTCCAACGTACCGA
CAGCACCTGCCGAGTACCCTGACGACACATATTCGGACCAGGACTACAATATGTCACCAATTCGACGAGGACGTAACCACATGAATCGGCAGGCTGAGTC
ACCACCTTTGACGCCAACGTACGGACCACGCCAAGCCAAGGTGCCAATCGTTGACGCCGAACCGGAGACCACCATTGGCGCTgcggtgaagatgaaaggT
GAACTAAGCTTCGAACGATTACTGCGCATCGAAGGTGAATTCGAGGGCAAGCTCAATTCCAAGGGATCCCTTGTCATAGGCACTCGCGGTGCACTTATTG
GCAATGTTGACAATATGAAGGAAGTGTACATCACAGGCGGGCGCATCGTGGGCAATGTCaatgtggagaagctcgTGCTGCGAGACAAGGCCCAGGTGTT
CGGTAACATCACTGCCAAGACAGTCAAAATTGAGCCGGactgcatcatcatcggAAAGATGAACGTGAACCCACAGGCCCCAGAGCGAATCAACGATAAA
GGTGAGGTTGTCAAGGATGATGCCTCCAACAGCACCCCGGCAAGCTTGCCGAAGTAGCATCTATTATAGATACGAAAGACATGCTTGAGAGTTTGAGCTT
GGATACTACAAGGCCATGACACACCCtaaacaaaacaaaacaaaatgatTAAATCCCACTTCTCGTTCATCTCAAAACCTTCATTCATCGATAATGTAAT
ATATACCCAGCATCTCCGTAGAAACCCTCCGTCCGCCTACCGTATTAACTAGCCTCAGCACCTGAGCGTGTTTGAAACCGAATATCTTGTGCATGTATTG
TCGCTGGAATGAAGCCTTAAAACTTGCCCGGGCGCCTGCGTCCGGTGAACTTGCTATCGgacttgaccttcttgcCCTGCTTGCGATAACGCTCCTTCTT
AGCCAGCACCCAGTCCCTGATGGTACACAAATCATTGGTCAGAGATCGGTTCTACCCCGCTTTTCTTGCTGACAAGCAACAAAGTTTAAAGACGTACTTA
GCCTTAATGGACTCACGACCCTTGCCTCGGCGTTGCTGTACATAACGACGTAAGAAAAACATTAAGTATAAGTGCTCAGCAATTACTACCACCCAGGAAG
GGTATCAGAGAGTTTGAAAAACTTACACGCTGGTTCCGCGCACGACCCTCGTACGAAATCTGGTCGGCAGTAGTACCCACACCAAGACCCTGCGGCACTT
GCTGATGGTCCGAGTAGCCGGCGAAAAGACAGAGATAAAACTTCTTGGCTTTGGCACTGTTGGGGAAGTCGATAACCAGACCACCAGAGAAACCGCAGCG
CATGGCTGTGGCTGAGATTTCCTCCATTTGCTGTGGCGTCTCCGGGTacaattgcagcacagcgCGACTGCCGGCCTTCAAGCACGTGTAAagcgacgtg
aagaagcgcgtAAGACGCTTACGCGCCGTGTGttccttctt