Description :
From Genome Similarity Track
Location :
Scaffold_18:494153- 496881
Transcript NameFunction/comments
Phyca_LT153416197Hypothetical protein

Sequence
2728 bases(100 bases per row)
aactttttcgtgagcagaacctcaaatttggttcagagatttgcgagggagttggagttttcttgcagagacattcaccaactattaccggatgatgctt
actcatttgggcatcatatcatggcaggtatgtatggcgtcgacgataagaatgctttattcacgtcaatcacttgttgttatcattttcaactagacta
ttttctcggatacgggtgttgaccctttgcaaaaggtacagattacgatctatgcttatttttcaggtaccccagacttacgtgattcctttggtttagc
cttggcttcacttgtttattcctaaccgaatgttgcttgatgagcgggatgcgaaggaaggctgaaaagcaccaaggataaaacaagaagctctttgata
ataacaaaaatcgcggcgcatttattgggttagccacctcaggtggcccacctgtgctcagtagatacagcaacgttgtcaggttcgctgtcatcctcca
aacaaaaaatactttcatccttgtacttgagcattgcgtaatcgctcttcgagatcgccacaactcttctcttcacttgcgatggcgatatatccagcac
tttgacaggagttgttgagagctcggggctgcaaggttcactacagttggtgtccatattaaagcatagatcagtactacaattgcatcaagggagagca
acaccaataaacgcaccgttttaacatgccaacccgaagttgaaccttttgtttcgactgcgagtcttcgtctctgcgggcactcacgtgaatgctcaag
atctcgcagacgttaaacaggaggcagtggtcagctacactgcctgaaatgtctgccatgacgagttctccggtgtagagtttcaaggtggatctacagt
gttccaacaagcaaattagttgctgcttcaaaacagaagaagcggaacaatgggcgtacttgtcactgtcaccgatctcagcgattgctgtagacacatc
ttcactgccgacacgctgcggctcgaatactggatcttccggatccaacattttctaaacagaaaaattcattttagcttctttagaccaattcgggtac
taagcaatgaattcagagttgcttacctgaagaatcatgcactcagtaacccactggaagtttttaaccggtacgtgacgttttctcttgtagtaccgac
atatctaacaatattagggaaaattagcaattgaacgtcaaacaacacattttcagcgccacttactgctgtgtactcgtcgcatagtacgatatccaca
ctgatatcagttttattggacaaatcctacgataaatgtcaataccgtgatacaagagcaggttactaaaaaaactggactcacctcgtacacagcgtct
gcaccacaagcctttaaaataaacgttatcaaactacgattctccttagcttctgattttggtgtctgagaaacatcactggcgatgccaaatgaatagc
cttcaaaaatgtgtagctgttgcatgtgcaagcgaaaataggttagtgtaaattctactaagaacgccatttgggtaaagtatacctgtgtaggaggaaa
gcactcagacttccgggtggtgacagaataacctgtaggtacttggtacccatcaaacggtagcacatatcccgcgtcaacggaatgtttaatccagtca
gtatggaccacaggtattccacacgcaacagctttcataaacttgcgcttcctccatgatacaggtgtggcgatcaccaccgccttagagttgcttttgc
acagtacgtcctcgtagcgttccggaattttaccaccatgtgctttaatatactccttcaaactctctactccagggttcacaaaacccgttaagcaaaa
ctcaaacttgtacttgaacagcgtttgagcacgagttctggacgcgtacattcgctgtaacggcacgggtgtcaaattccgagctcgtgttcgaacttgt
ggggtcgacgacggggttgactgggctgatcgagtgctacgccgcgcaggggggcgtggtgtttgaggattggaaacatcagactctttcaccgaaacat
cagactctttcaccgacctactgccctcaggagagaagacaccacgctttcttttcttgggggtgggggtggaggcaacctgaccgggggaattggtagc
ttcagacaaagttttctgcttcttattgcctctgggtaccccagatcgcaacggggaaacaatttttctcttggtcgtcacttgagcttcggtcgcggta
acagtaggctcagcatcagggacagctagatcatccactggagttagcgtagcctgatagaccggactgatagaagcctcgaaaggactgggtctgttgt
ccctcgagaaagcttcaatttgcttggccgctggagtgccctcacttgtcaaacttgcactaaagtgaggttcaccatcttgcgactctggcatcgagaa
agaaaattcaaggctgcgaatagctttcgtctgcgaatcagatgcaacgacgacatttttcctggcaacatttgacggaggaggcgagtttggctcaacg
acgggttcgtcttctgtacgaggtttactgggctgagtaggcacacaatcttctggctcatcgtcactttcctcctttcccgaatcctctttctccttac
cacgagactcatcagcaataacggattg