Description :
From Genome Similarity Track
Location :
Scaffold_6:494144- 498300
Sequence
4156 bases(100 bases per row)
CTTACTCACACTCTACTCCACATTCTCGTAGTTATCCTTCACTATTTGGACTCCTCGTTCCACTGCGTTCTCAGGTTGTAGTTTTATCTCTCGCAGGTAA
CACGGCTCCTCAGTTACTGTTCTCTCGTTGCGTCGGCCAATCTTCTCGTTACTGTTACTGTCTTCTTCTTCTGCACTCTCTTGTACTGCACTCTCTCGCT
CCACACTCCACTCTTGGTGTGCTCCGAGGACCATCGACACACCGTCTAGTACGGGCTCGAGGGCTCCAAAGGTCATAGGTATTCCTTGCTCCACTTTTCC
AGTTACACACTCTCTTTCTTCAGGCGATTCACACTTATCCAACACGGTGGGTTTCACTCCACCCAGCATAGGACGCACTTCATACCTCACGGTCGACTCC
TCCAAGGAGTTCAAAGTGTTCCTACTTGTGTCGTTCCATTGACAAGAGGAAGGAGCGACACTCCCTTCCCCTCCCTCTCGCCCCCATCACTGCTGTCGGG
ACGCTTGTCCTTGGACTGGTGTAGACGCTTGAGGAGCAGCCGTTCCAAGAGTCTTCAGAGACGCCTTCAAAGGACAGTCCGAAAGCAAGTGACCAGGTTC
GTCACACAAGAAACACTTACGACCGTTCCTCGGCGGGTTGTTCCGATAATCGTTCGTAGGAGGATGTTCACACTCGACGCTGATATGACCCACAGCCTTA
CAGTTGGTGCAAGTTGCCCTACCTCGGCTACAGTTGAGCCGGTTACATCCAAGAACGTGACACCTACCACACACAATCTGACCGTCTTGAGTGTACAAGT
CCGGGCCATGACGAATGCCACGGAACGGGGTAGTAGGAGTGGTCGCGGCCGGTTGAGCCTGAGGTATCGGAACACTCGGAGCAGGAGGATAGTAAGCAGC
TGCCACATTCATGGCAGGAGCCGGGTAAGCAGCAGCCAGAGGGCGTTCCAGCAACTGTTGCTGCTGTTGCTGTTGCTGCACAAGCAAATTCTGGGTCTGT
TGCATCATGTTCATCATCCGTTCCAAAGCAGCGTTCTCGGTGCGATCGTCGAAGTGTTCTCGAACTCCTCGTCGTTGTCGGAAGGAAGATGCATGTTCTT
GAACAGTAACTGTGTTACAGCACCACGGATCGAGTCAATCATACTCCCGTCGAGAGCGGCTCTCCACTGCTTGTTTCGTAGTCCCGTTAGGAAGTACTGG
TAGCGTATTTGCTCGTCGTAACACTGAGCGTCGTCACACAAGCCCGAGATCATGTCGCCCCACACTTCGGCGGACATTCCTCGCGGACGCTTAGTGTTCT
GGAGCTTCTCGATCAGCTGCAACGGAGTCTGGCAGATAAACTGGTTATGGAACCGGGTTCGGAGAGTGTCAAAAGAGTTGATACGAGAGTACGTCCACCA
ATCCTCACCAGTCTTGCCCTTCAGGCACTCGCGGAAAGCACTTAGACGAATGGATTCCTCCAGACCCACAGTAGCACGCTCAAAAGAGTCCCAGAACGTC
TTCGCCTTCTCGACCGACGCTCCATCAGAGTAGAACGGCTGAATCATGCGGATAGCGTTCCGGATGTTAGTAGGCATCCCAAAAGGCACCACTGCAGTCG
ACGGCGCGGGATGACTGTACCCAGAGGCGTAGTTACTGCCATAACTTCCGTTAGGGCCGCCCCATGGAGCTCCTCCAAGGTTCACCGCCGAGTAACCAGG
CACAGCGGTCCCATATCCTCCAGACGGACCAACTCCAGCAGCAGAGGGTCGAACAGTCGGACCGAATCCACTTGTCGTCGGGGAAGTGTTTACCGGCCTC
GGACCTTGGTTAGGCTGAACGGTCGCGAAAGTGACGGCAGGCGCCCCTTGCGCTGGAACTCCTTGAGACACTTGGGACGCTTGAGTTACCACCGGGGGAA
ACCCCACGCCTACTCCACTACTAGGAGCCTGGGCGTTCCAGTGAGCAGCTCCGGGCCCACTCACCAACGAACTTGGGGCGACGGTCACAGGAGTGCTTCT
CTGCGTCGCGGCCGGCGTGAGGAAGGGATCAGTTCCTAGTCCCACTGTCGCCGGACTCTGGATGGTGTACCCTTGATAGGACGGTATCGCCATCCGGACT
CTCGCAGGGGAAGGGGTCACTTGCCCGCCGCTCGGGGGTACCGTTCCAGTGTTTTCAGTGTTCCAAGGCTGCGAGGGCTGCCGCGAAGCACCAGGGAGGT
TCGCCGCCATTTCAGGAGGCGCCATAGATTGGAGCCATCTACACGCGTTAAGCCAGCCTTCAGTCGAGTCGGTAGATCCGGGCGGGAACGCCACGAACGT
GTCAGGGTTCGAGTCTTGAGGCGCCGCGGGAACCCTCGTCGAGGTGTCTCTCGGGACCGATCTTTCCTCAGTCCTTCCAGTACCCGCATCCGGGCCATTC
TGATCACGTACTTGGGCACCGGCACGTTGTACCATAGAGTGCACGGCCCCAATATCTTCAGTAGTAGTCAAACTCGGTCGGGAGGGATCAGTTAGGATCT
CCTGCGGTCCAGCGACCGTTCCTTCGTCTCCAGACTCGTCGTAGACGTCTTCGGAAGGGCCTTGCGCGGAAGACATCTCAGCCCCAATGTTTCTCCGTCG
AAGGAGTGGTAGTACGCGCTCTTCTGTGAGTCTTCACTCAAACGAGACTTTCTCCAGCAAGCAGACTACCCTGCTTCTCCACCAAGTGTCGTAGACTACC
TCCAGGGTCGGGTAGTCCGCGGCTGTTCAGGGAGTACGGTCTCGAGTAGTGGCAGGAGCGGTAGCACAAGATAACTTAATATACCAAAAAGCTTCTTGTT
TCTTTCCCTCACTCAGCTTAGGCAAGAGGTAGTAAATGTAAGACTGAGACTAATGAACGAGGGCCTACCGCCAACTCGCTTTCCTATACACGACACCGCT
TCAGTTTATCTTGATCAAAAGAGTCCTTCTCCATGACATCCGCCCTCGTGCGGCGACAGGAAGGTCCGAGACGCGGTCCACCTTGCGCATACGGCCTTGT
CCCCAGCCACGTAAGACGATAGGAGGGAGCTCACATACCGTTCCTTTACTCCATCGTAGCGTTCCAATACAATCACACCATAACTTCACCGGTCTCATGT
GCGAAGTGAGTGGGAGCTTGCGGGGTCAACGGGAACCAGCCGCCCGCCGTCGCAGCTCGTCGACCTTCGCTGAGATTCCTCGACACAAAAGCCTGCCCGC
CAGCGCCTGGCACGACGCCTACGTTCCCGGGTACGGGACAGCGGACCCTTAATAGCTTAATCGTGTAGTGTTGAGTTTCATCGCGAGTCGCCCTGGAACG
GGAGTCAAAAGGGCTCCAAAAAAATTCTGATGGGGTCCCACCAAAATGCAAAAAGGGGTCTGGACAAAATTGTGCTGTGCATAAGCCACTACACACTGAA
TCAGTGACTGATGTGCTCCACATAGTATTTGAAAGACAAAAGACCTAGGCAGCGTTGGCGGCGGCGCTCGGCGTGGTGAAGATGCCGCTTTACCGACTGC
CAAGTAACGGAGGCGGTCACTACAGACTACTGGAGAGGTGGCGTCTACGATGAAGACTACTAAGACAACCAATGTGGCAGGGGCGGCCAGAGATGATGAA
CAAGATCATGGAGGTCATGGAGATCATGGAGATCATGGAGATCATGGAGATCATGAAGGAGGCCGGAGATGATGGAGGAGACTATACAAGGACTGAGGCG
ATGTATTTGGGGGAACGATTGTGGTGGTGACCTCAGAGGTGCCAGAATCGTCGAGATTGCTACCACAGAGACGCCTGATAAGATACTGCCCAGGAGCTAG
CTGCCACAGAGGCTATCGTGGGAAAAACCGGGGGAATACCGAGACGACCAGAGCTTCAAGTCGTAGACACATATCGCAGCATTCATGTTCAATTTATTTA
GACTATGGTCACGTTGGAGATAAGCGTAATATTAATGAAGGAAAAAAGAAAATGGAATTCATGTGTTAGAAGCACATGCACAAGTATCTGTAGCGCAGGT
ATTGAAGAAGACTTCTGCTTCTTTTACCTGGTAAGTTCGCACCACAAAGAATCTCAAATGATAGTAGTACAAACAACCCGCAGTTGTAGTTGTCCAGTTG
AAAACCAAATTCAGATTCGTAAGTACGAAGCCGATATCGTGTTCTCGAAGTTGGGA