Description :
From Genome Similarity Track
Location :
Scaffold_97:4941- 7476
Transcript NameFunction/comments
Phyke_g4222conserved hypothetical protein
Phyke_g4223hypothetical protein

Sequence
2535 bases(100 bases per row)
agcagctcgctctCGTttcagatgcagcagcccaTGACCATTAACCAGAAATACCAATACGGATCCAGTGGCCGTCGCCATAGTCATCACTACCCGCCAC
TGCCACCGCGCACGATGCGCAGACGCTCCTGCCTGCGCAAAGAGAGCGCCTTCACCTGCACCGGGGCCGCCCGCAGCTCACGGCTGGACGAACTATCCAC
GACCAAAGTGATCACCGTCAGCTACTCTGCACAACCCAAGAAGACGCTCTCGTTCGCCGACCAGCGTGGCCAGCACCTCGTGCTTGAGCGCGAGTTTAGT
CCACAGGATGCGCCTGTGTGTTACTGCGACGTACCGATCGAAGTCACTATTGGCCGTCTCACTCGGCGACGAAGTAGTAGTCTGGACAAGTGGATCGAAG
AGACGGTAGCGCGCCAGCATCTGCTCTCCATGTGCGTCGTGTCGCTTCTGGGGTGCGCCTTGATCGGTCTCCGCCAAACCGCCAAGTAAAGCGggctgct
cttcttcttgtagcACTAGTCAATAATTATTCGTACGCGTGCAACGCTTAGTCAGCATGGCGTCATTAACCTATTAGcaaataaaaaaacaccTGTTAAC
TGCAATCTTGTCACGTTATATGCGTCGCTTGTTGGTGTCGGTCATTGGCCGCTCGAGTCGGTTCTTGTCCAACGCAATTTCCTGCTGTAGGATGCTGCTC
AGAATCAGCTCCGTGGAGTAGATCCGCTCGGGGTTCGCGACCGCGAGttgcttcttcacagccgCCGTCCCCATGGCAGCTTCGCTTGTGATTACCAAGT
CATTCGGCCCAGGCTTTCCCTTTGAAGAGGCTTTTCCACCCGCGCACTCTACGATCTTCATCAGGTCCTTCACCGGGGGCTGTACAGATTTGTGTGCAGT
AATAAACACGTTATGGCCAGAGAACAGGTGCATGCGCTGCTCGCGAGGGATGCCATACATGGTTCTTCGCAGACTGAACTGCCATTTGGCTTCCGCTGCC
TCATCGAGCAAGCAATTCGCTTGCTCACTGACCGAGGCACCCACCCGAGCTGACTCGTCTAACCAACGCTGGCCCAAAATGTGAGTACAGCAAGAGATAC
CGCACAGCAGTTTAACGGTGCGTTTGAGCTTGTTCTGAGGAACTAACACATGCGTCGCCTTCTCAATATTTGTCTCGTACACGACACAAGCAATAGACTT
GATCTGTTTATGGATAGCGGGGGTAGCATCCATTCCCGTTATAATCACACGAATAGGTGTGCCTTCTGCTTGCGAACTGGTCAATTCGCTGTCAGTAACC
GATCTGCTACTGGGTGTCGGCTTTCGATGATGGCTTGAAGCAGGCCATTTAATCTGAGCGCGCGGTTTTACATGCGACGGTGGCGGCTCTTCCACCCTGG
CACGTTCAAttgacagcagcttgctcgcAGCCACACGAATATCCTTAGCGCTCTCTTCGGTGCACTTAAAGTCACTGCTAGCTGGCGGTGTTTCGTGCTT
GGACTCGTCACTTTCAACTAGCTGTTTAGATTCTTCCACTGACGAAACATTCTGGTTCAATTCAACTGGGAGAGCTGCATCGCTAGTACGACGAGATCGT
TTTGCCTTCCCGCCTCTGGTTTTGGACTCTGGACCATGGTTCCTCTTCGATATGCGATCTGGTGTTGATAATGATCGCTCAATACCTTTCGTTTCTGCAT
CTACAGGCGTCTTCGAGTAGCTTGCACTTTTCACTAACCGCCGTGTCAGGTTTCGCTTATCGCCTCTGATTGGAGGTGCATCCTTGTTGTATTCATCGTC
AATCTCTGTCTCCCCACcactgccttcttcttcatgcactgaaactgctggagaaattcGAAAGGAAGTGCGAGGCTTGTACACATGCACAAACTCTTTC
TTCATCGCTTCTACTTCTTGGTCTCTCTGCTGGAAGGAAGCAGCGATAGAAGACAATCCGGCCACCGAACCATCTTGCTCCAGCATATCATCTGACATGT
CCGAGTCTGCATCATCTGAGTCAacagcttgagctgctccatcagcaccatTACGTCCACCACTCGCTGTTGAAGTCAACGGCAGTGGCACTGCTTGTTC
AAAAATCTTCCTTTCTGCCTTCACTGCTCCTAAAAAGCACACAATAACCACATTAATTTGTCTCCTTAAGTCTCCAATCGTCCAATATTGCACTTACCCT
CTTGATCTTCAGACATAGACATCCGGATCTGcgtctcctcctcgtccacgtcTTCTCCGTCGTGTTGAGACCTCTGTACACCAATGTCCTCCTCTTGAGA
TGGCAACGCAGCCACGAAAACTGGTGCCAAACCTTCTGACACCACTTGGGTCGCTTGGCTGTCGCGTTGCGTCGGTTGTTCACCCAAACGCGGCGATGTC
CCGCGCTTGCGGTGGTTGGCAGTATACCACTGACCAGGCAAATCACGGAACCCCACAGGGGTCTCTTGTCCCTGCGAGTCTTCGAAGACGGCAGCACTGT
GGCCAGCCATCTCTGATCAATCAATGTCAAATCAG