Description :
From Genome Similarity Track
Location :
contig_120:4941- 6964
Transcript NameFunction/comments
g11366.t1hypothetical protein
g11367.t1hypothetical protein

Sequence
2023 bases(100 bases per row)
TGAAAGCTCGCCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATTGTGCTCAAGAAGAATGGAGTTGATATTCGATTGTGCATCGACTA
CAAGCTGGTAAATGCAGTTACGGCGATTATGGAGTACGCCATGCCTTTGGTCGACGACTTGTTGACCGACCTGGAAGCCTACTTATGGCTCTACTCGCTT
GATGCAGCCAGTGGCCTCTGGGCCATTATGATGACGATGCGGGCCGCAAGGTCTCGGCCTTCGTTTGTGCGCTTGGACATTTCGAATGGCTCCGCATGCC
GTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATCGACAATGCTCTGTGGGGTTTCGTCCAACCGAAGGGCGATTGGCTCCACTTTTCGGAG
CTTATTCGAACGGCCGAGGCACACGCCGAGGCTGCACGGACAGGGGTGATCGACCCTTCACTGCGACCACCCGAGGACTCAACCACTCTGCCGACCAAAT
TCGAGGCCGACCGAGAGTCCTCGGTCACGCTTGATGCGGTGAATCAGTTAGTGAACAGCCCTATTGCCGACATGTTCTTCGCTGGAGACCTGGATGAATC
CTTGTTGGTGCCAGTGTTCGACCGGCGATCGTTCGTCGATGATATCTGTTTTAGGTCCGAGACTTTCGACGCGTGCCTGGAGACGCTAGACCAACTGCTC
CAACGGTTCACTGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCGAAGGTGGACTTCGTATCGCACAAAGTCTCTGCAGAAGGTA
TTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCGTTCCCTGCTTCGGAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTACTACAC
CAGGGCTTCGCAGTGTATGGAGCAGCTCTGTTTCAGTTGAAGGACGAAGACTTCACACCTAGTGGCAGCCTCTCGGCGGCCAAACGAAGCTTCGCGGCGC
TCCAACAGAAGGTTGCAGAAGCACCGATCCTCCGGCACTTTGACCGAGACAAAGAGGTGCATGTCACATTAGGCATTGAGCTCCACTTTGATGCAATCCC
ACGATGACAAGTTGCACCCGGTCCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTGGCACTACTGCT
GGTGTTGAAGGTGTGCTACTCTTAGTTGATGGGTCGGACCATCCACGTTTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAAGTCTAAGACACTGTT
CGGTCGAGCGACCCATTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGTCCAGCATCTACAAGCC
GGTCTCACAAGCTTCGTTGAATTGGAAGACTCGTTGGCCCGGTTACACCTCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCATTTGCTTTATGCC
TTGCCTACCGAGTTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGATCGGAAAAGAACGGGGTATGGCAGTTGCTCGTGGACTAGCCGAG
CGCCGCCCGCGTTGCGGGCAGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTGCTATGACAGGGTTATG
TTTTATATCAGTATATTTTACAGTAGACTTATACCATAACCCTAAGCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCC
TGGGTTTTCCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAG
TGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTAGCCGTGTACACTCC
GTCTTCTTCCTCCCGCTCTGGAT