Description :
From Genome Similarity Track
Location :
Scaffold_32:494037- 495659
Transcript NameFunction/comments
Phyca_LT153418035transmembrane protein, putative

Sequence
1622 bases(100 bases per row)
caccaaagaccccgaccaatgtggctacattggcatgaaaacgcccgacaccaacccggagatcctggaaggcggcgctctgcgtcccggtgggatgccc
gtgctaaccaccaagaaatacgtgggcctgctcttccagtacgctgctgtcggtatcgtttacggtatgctacctgagaccatctaccccttcatgcagg
agtatcttaactgcagtggcgcccaggtcgcagccgcgaaagaactggtggtattaccttggagctttaaggtgttcttcggtatcctgtccgactgctt
cccaatctggggctaccgccgtcgtccatacatgatgatcggttggacggtgtgtatcttgatgctattggtcatggctatcattcctattggtaaaccc
tactacaccgtagcatcggaccgcgacatcgatacggctgactacacgccggaaatcgaggctcgcattaattacaacgccccaggagaaggtgccaagt
acatcatcatcatgttcttcgctgcggttggatacgttttagcagatgtctgttccgacagtatcgtgtgtgaattggcccagcgagagcctttggcgaa
gcgtggcaagacccagtcagccatttacgcagtccgttatgtggttgtgatcctcggtgaactgctcgtcggcttctgcttcaatggcgaggagtatggc
ggagacttcgacttctctttaagcttccctcagcttatgatcatcatgactgtactcactgcgcctatccttcctattgcttggttcttcatctacgagg
agagagcggagcgtcaaaacttccgcaagtacatcaacgagttctgggatttactctgtaagcgcgtcgtgtaccagatcatcgcgtatcatttcttcgc
tggtattttctccggtatctcgtataccgctagctctcccgtgcagtcgtatatggtggatgtgacgcctatcaacagtacgctgaatgatgtcctcggt
catgtttgcttcttgatcggcatcatggttacttcgaagtatggactccactggaactggcgcgctataccggtatcgtcgtcatcgttatcgactgctc
tgtggctctcattactgtgtgggatgtcttccgtaaccagtggttctggctcggccctccaattgcagtgcagatccctagtggtgtcgcctggatcatt
gcgctgtttgtgacggttgagattgctggggttgggaatgaaggtgctgtgtatggactggtgactacggttggcaatctcgcaactccgttcgctacta
ccattacacttctgattgacggtccgttcaacatcacgaacgctcgagtgcagacggatgaccactcggttcgtgtggatattacctatacgattattat
ctcgtacgccatgacgatcttttcgtgggtgttcctgttcctactgccacgccagaaggaggagacacaggagctcgctcgcactggtggatccaaccgg
attctgggcggaattaccatcttctacttggccttctcgcttgtgtggtctgttacggcgaatactttggcggtgttcgatagcacgtcgtgtctggtga
ttgctggcggcactggttgcta