Description :
From Genome Similarity Track
Location :
Scaffold_527:4940- 7210
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_527-snap-gene-0.9Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_527-snap-gene-0.12Glycoside hydrolase

Sequence
2270 bases(100 bases per row)
CAGACCTGTAGCTCCGAAGATCCCCAAAATCATAATCGGGACTGGTGCTGATGGAGTCAATATTCCGGCCGCTGCACGATATATTCAGCTGCTAGGACTG
GGAACCGTTCTCACCGCAGGAAACGAAGCTGGACTGTATCAATTGCTCGAGTCAGACGAAGGCAAGGGCGTAGATCTGGTAAGCGCAAGCTTGACCGGAT
AGATCGCTTAGCGGTGTTGTATGGGTGCCACAGTGCAACGACTGACTTGGCACTTTTATTTGAAATCCAGGTTTGCTTCGATATCGGGGCTGAGTTGGAC
ACTGCTGTCGAAAAGCTGCTCGCATTGCAAAACGTCATCGGCAAGCGTGTGATCATCTTTGGCGGCGACATTGACGATCCGGAGAAGACCCACACTGTTG
CAGAGGCTTGCTTGGCAGAAGGAGCAATCTTTTTCTCCACTCTTCCAATAAATTTCGCCGAGCTACGCACGGTCATTGTAGCATTCTTTGAAAACTCAAC
ACAACCGTATATTCTGCGCCAGCGAAAGCCCGTCGGACGAGCTACAGCAGCGCTGAAGATGGCGAGCAGGTCAATTGGGGCTGCGAGTCTCTTTGGCTTG
CACGATAATCCCCGCAAACTGTCAACGCCTCCTTCGTATGCCAATATTGCCAAGCAGTCGATGCGAAAGCCGACGGTGACGATACTACCGGTATTAATAC
CCCCGGTCGTGAAAGAGACCGCAACTGTCCTCCAACTCCAGCTCAAATCTTTGGATGACATTCGCTTATCAGAAATGATCCCAGTCGCACCCATGTCACC
TCGATCACTGCAATCGTCCAAGAAATCATCTCCACGACTCTCAGTCGCTCTCAAAAAAATGATGCGCTAGCCTCTGACTTCCCTTCGACAACAGTTTTGA
TCTATATCTTATTATTTCATCAAGTTAGTCATGCAAAGCAAGACATAATCAACAGAAACTGTAGGAATGTCTAATAATTCGCGTACCATCCATTTCTATC
ATGACGAACTTGGTTTCCTTTAGCCGGCATTCTTCATCTTGAGTGGTTCTTTTCCATAAATCTTCTGAAACACACCCAATGCGAAGTCAACCACATGGAT
ATGGAAGAGCATGTTGAAATGGTCGACCCAATATTTGCAAGTTCCCAGCAATGTTGTTGGCTGGTGCTGGCTGGCATTCGAATAGAACGAAGCGTGACCT
TCGACTGCATATTTCCCCATGACAGAAAAGCGCTCGCTACAAGTTGTAAAGGAAAAGTATATCAGTTTCATTCATATCAATCATATCATAGCAAGACATC
CAGCAAAGATAATACGCACCGAGACGATCCACCGAGATCCTTGTTCAGCGATCGAATCATGTTGTTCGTTCGAAACACAAACAGCATATCACGCGGTAGT
TGCTCCAAGAAATCCGTCACCTAGGAAAAAAAAATGCTATGTCAGTCCAATGTAGCAACCAGAGTGCAATGACCCGCAACGAAAACTTACGCTTGAAAAC
TGCAGCTTCTTCAAATCTTCCGTCAATTCTTTCTTTTCGCCCTCCGTCATCGAGGACGCTAGTGGGGTCGTGCTGCTGATTGTTCGATACGTGAACAGTA
ACGGCAGATATTTGGCAAATGCACCGACGTTCAACCGCTTACTACAGTCTTCCAAAAGCGCTGTATCACGGAGCAACATCGCACGCCAAAGATCACAGTA
CGTTTTCCGGAAATCATCGTCAAGCTCTCGATAGAGTCCGTGGTCTAACAGCACAAGCTGTTCTTTGCTCTTCACTTTCGGATTCGGGTTCTGGCGCACG
AAAATGTTGCCTGGATGCGGGTCACAATGCACAAAGCCGTGGCAAAACACCATTTCGCCAAACACTTCACACAACACGCGCGCAACGTGGGCCGGATCAA
GCCCCATTTTTTTGATCTCGTCAATCTGCGAAATTTTTGGTGCTTCAATGAATTCCATCGTCAGCACTCGCTTTGCACTCAGTTCATCATACACAATGGG
AACATGCACGTTCGAGTTGTGCTTCAGATGATCAGCGATGCGTCGACTGTTTTGTTTTTCATTTTCAAAGTCCAATTCAGACCGAAGTGCACTCTCGAAC
TCGGGAAACAGCCACTGGATCTGGACATCCGGAAAATAGTACTCGGTCAACTGAGCGGCCCACTTCATGACACGCAAGTCGGCCTTCATTTGCAGCGCCA
AATGTGGGTACTGAACTTTTACCGCGACGGTGCGTCCCTGCTTATCGACGGCTCGATGCACCTGAGCGAG