Description :
From Genome Similarity Track
Location :
Scaffold_556:494- 5846
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_556-abinit-gene-0.10CENP-B/ARS binding protein
Pytir_DAOMBR486maker-pir_contig_556-snap-gene-0.2RCC1 and BTB domain-containing protein

Sequence
5352 bases(100 bases per row)
TCTCGATGAAGAACTCGGTCGCCTCCAACAGGGTCAGCTTGCGCTCAGTGTTCGACTCCACCAAGTCGAGACACCAGCGAAGAAAAAAATGTACCGAGCT
TTGAAGGAGCGATTGATCCCTTTGCACATAACACAAATAGAACGTTAGATAAGTAACATAAACAAACAACAGATTACACAGATAAATACACACCTGCATC
CAGAGGCTGGATTCTTGACGTCATATTCGGAGGAAAGAACACGATCTCGACATTCTTGTGCTCGCACATGGCTTTGCGACTCGAGGTATTGTCCAGCAGC
AGGAAGGCGCGTCGTCCGTACATAAGCAAGTTGAATTTGCGCAGCCATTTGTTGAAGGTTGTCGTGTTCATCCAGGCCATCGGGCTCGCGAAATACTCTA
CCGCTTTCTTCGCGACGACGATTCCTTGAAGCAGCGCGGCGACTTGGCGCTCCCAATCACCAAAATTGTCATCTTCTCGCTTCCGCTGGCGTTGCTGCAA
AGAGCAATTGTAACTCGTGCCTTGACTTTCTTTCTCCCTCTCAGTTAAATGGTGGCAAGAGTTTTGTTCGGCGGTGAGCAATAGAACAGTGCTGACTCGT
CGAAATTGAACGCGTCGTCTGGGCTGTAGTTGGCGATAATTGGCTGAATCTGTGTCTGCGCTGCCTTCAATGTCGTCTCGCACACGCTCCCGCTCTCGCC
ATGAAGAGTACGGCTTCTGATGCTGTTCCTCTCCTTGAATTTACTGAGCCAACCGTTCGAGAGCTGCAGCTCACCCTCATTGATCTTCAGCTGCTCACAC
AAACGCAAAGCTTTCTCAAGAACAAGGTCATCCGAAAGGCAGATAACGTCTTGTTTGGCAAGAATGAGTTCAATCAGAGCCTTCCCAAAGAGAGGGAACT
TAACTTGGCGTGTTTTCTTCCGCAACGGATAGGTGTCGCTGAAAAAGCAAAACGAGAGCTTCAGAAACTCCGAGTGTGTGGAAACGATTCAGGAGGGGGG
GNNNNNNNNNNNNNNNTGCGCATTACAACTCCAGCGAAGTCCTGCAAGCACCCATTATTTGGGCACGCACACACACGTGGCGCGTAAAGAGCTGGAAAAA
CATACGCATATTCACCGGATACATTTGCTAGGATGCGCTCAAACGAAGTCCCTGAACACCATTTACCAGCTCGTACATATCTCACCCAGCACTCTAGTGT
GCCGCCAGCAGTTGTTGGTTGTCGTGCTTGTGATCGCTGCCTGTGCGTCTTTCGCCCGCTACATTGTGACGAGCAAGCTAACGTGATACAGAGGCTCAAC
CTCTCCTCATTTCTTGGGTTCCCGCCTGCGCGGTGGCTCAAAATCTCATCCAGCCTGTCAACCACGTACCACGACTGCAACTGCGCGATCCGCTTCTTGA
GTGCTTGGGTGGTGCCAGCGTCTTGGGCCTGTTGGTGCGCGGTCGCGTTCGGTGGCAGCACCTGGAGCGTCACGTTTGAAAGCGGCTAGGCGGGGGCGAT
GAGGCGAAGCATTGTCGAGCAGCAGCAAGACCTTGCGATTCTCTGAGCGCATGCAGTCGTTGAAGTGGTGAGCCCAGATTTGATAAAGCTCAGTGTTCGT
CCACCCTTTCGGGGTCGACTCGTATTCGAAGCTGCGCTGCTTGCCCGACTTATCGCTAATGAAGAGCGGGGGGGNNNNNNNNNNGGTTGCACGACTCGTA
TTTGAAGTCGAGTTGCTCGCCCGACTTATCGCCAAAGCAGTGAGGCCGCCGCGCCGCGCCAACGAAGAGCAGGGGGAGCTTAGTTGAGCCGTCAGCGTTG
CACGTAACAGCGACAGTCAGTCGCTTCTCTGCGTTCTTGCGTCCCGGTATACGTTTCGTCGAGATGGACTTGTTGGGCGGCGTGCAGTAGAAATACGCGG
TCTCATCCATGTTGTAGATGTCGCACTTTGTGGAGTCTTGTGCGATTACTTGAAGTACAGCACGCCCTTCTTCAACGCTGACTGCTTTGGTGGACGCGGT
CTCACCGTACACGCACTTTGGGGTGAGCTTGTGACACTTTTGAAACTTGCACAGCCATCCTGTAGAGAAAGTCAGAGAGGAAAGTTTAGTTGCCACAGAC
GGAGCTGCGTCTCGGAGAAGCTCNNNNNNNNNNTCGCCTTCCCCAGGGTTGTTGCGCCGGTCACAACGGGCATGTTGCAGCGCTTGCAGTTGCGAATTCA
CTTTAGTAGCGTCACCTCGAGCGCCGGCGAGAGGACGGGCTGGCATCTTTTCTGCTCCGGGCTGGCTTTGTTGTCGTCTTTGGCGACCAGAACGCGATAG
ATTGTCGTCCTTGGCGGAGCGCGCGACAGTCTGAATGCGGTCACTGCCCACTCACCAAGCTCATGTTGCGTCATTGTGGGGCGCGCCCTGTGCTGCGCCC
TCATTACTTGCTTCTGGCTGCTTGTCATGCGTGCGTGCGTGGCGCCGGCGATCATTCTCGTTGATGATGGTTGTTTACTTGCTTGGTTGTGAGTGAAACC
ATGCGAGAAGAGCGCCAAACGTTTGAANNNNNNNNNNTTTGTCGAGAGGGTGTGTAATTTGATAATCTATCGGATTTTAAAGGGTATGGTTTATAAACGA
TGTTTCAATAGGGGAGAAATGACTGTACGATGGAACACGGCACGGGTTATACTTATTTTTGCTTGCTGAACTCGCCCTTCTGAAGACCTGAAGTTTGTTT
TATCCATCGAAGTGCCAGGCGAAAGAATGGTATGGAAAGCGATCGTGGTTTTAACGTCGCTTTCTCCACCTCGACAGTGTCCGTTTGTCTTATTAGGTTT
GTCTGGGGTCTCCTAGCAAATAGTTATCTCTCAGTAAAGCAGGTATTCTGCTGGTTCCTTCAAGACACTCTTCTGCTTTCAATTGTCGTCCGTGACTACC
GAGCCAAGGTGGGATAATGAGTTGCGCAAATGCCCAACAGTGGTCCCGAAAACGATGAGTGCATGTCGACAGGTTTCTCTCTCAAGCTCGTCGAAGTAAC
TAGCTTATTCACAGTACGTGGACAAATCTCACGTGCCTACTACTACTACACCATTGCTCAATTGGTTTCATGANNNNNNNNNNTGTCTATGCTGTAGATG
TCGCGCTTTGCATAGCCTTGTGCGATGACTTGGAGTGCAGGACGCCCTTCCTCAACGCGGGCTGCTTTGGTGGATGCGGCATCACCGTACACGCGCTTTA
AGCTGAGCTTGTGGCGCTTCTGGAGCTTGCACAGCCATCCCGTAGAGAAAGTCTGTCACGGGGTGTGAGGCCCCCGACCTTGTCGTACACGTGGTCTTAC
GAGGAAGCTTTGGGTTTAGAGCGCTGGCTGAACGGCCTGCGCTGAACTCGGTATTTTCAACTCTGAGGTATTTATTATCGGATATGCAATAGTGATGAAA
GTGAGGGACCTTACTGTGGACTACTCTAATAACGGACCCCATGATTGGACGACCACCCCGGTCGTCTAATCAGTGGGAAAGGACGCAATCAGAAGTGCCC
CCGGGGACACTGTACTATATCGTACATAGCACAGTGACCCCGTTACAAAGTCAGCAAGGAAAATTTAGTTGCCGCAGACGAAGCTGCGTCTCGGAGAAGC
TCTTCACGAATCTTCTCTGCCTTCCTCCGGATTATTGCACCGGTCACAGCGGGCATGTTGTAGCGCTTGCAGTCGCGAATCCACTTTAGTAGTATCACCT
CGAGCGCTGGAGAGAGGACGGGCTGGTATCTCTTTTGCTCCGGGTTGGCTTTTTTGTCGTCTTTGGCAACCAGAATGCGGTGGATTGTCGCCCTTGACAG
AGCGCGCGACAGTCTGAATGTGGTCACTGCCCAGTCACCAAGCTTATGGTGCGTCATTGTGGTGTGTTCTGTGCTGCGCCCTCATTGCTTGCTTCTGGCT
GCTTGTCATGCGTGCGTGCGTGGTGTCGGCGACCACTCTCGTTGATGGTGGTTGTTTGCTTGCTTGGTTGTGAGTGAAAAGCATGCAAGAAGAGCGTCAA
ACGTTTGAATTGCTTGAAATGTTTGTCGAGAGTGTGTAATTGGGTAATCTATCGGATTTTAAAGGGTATGGTTTATAAACGATGTTTCAATAGAGGAAGA
ATGACTGTACCGCTATCGAGCGATCAAACGATTCAGTCACTTGTAAGAGCCAATTTCGATGTTTGCGGTTATAAGAGCAGCTAGGGTGGGACCAAACTCC
CAATGGCCCTTGATGACATGAGTCGCATGCCTCGCCAATTGTTTATTGACACTCGAGTTTATTTGCTCAAACTATGAGTTTCCATACTCTTATGGGAGTT
CAGGAGCTCAAGACGCGTTTGGTAGTCACATCTGGAGATTGTGCCAGCTCCAATGAGTTCAGGATGGAGGTGTGTGGGTCCTGGCGTTCCATCAAGGTGT
GGAAGTAGGTTCTATAGAGTTGGTGTACATCCTAACTGGTCCAGAGTGTAACTGATGTCGAGCGTGTGCTGTACTGACTTTGTTGATCCGAACAATCCTG
TACAATACAAATAGTGAAAATAATAAATTTGTCATGCATTTTTTGTGTGACTCCCAGGTTTGAGTGGTGCGGTTATTTTGAGCGGATTAATAAAAAGCAC
CGGTTTGGCTTGCTATTGAGCTATCAAAGCTCACTCACTTAAAGTAGGTTGTTGCTCACTTGCTAATGCGGCAATTTGGCTCAAAAGCGAAAAGGAAAGC
ACAAAGAGAGAGAATGCGCGCGCCGCCCTTTGGTCGCACTGAGCACCGCATGCGCGGCTGAACGCGCCCCGTGTCCCCTCACTACCGAATTCCATTTACT
ACCAGTATTTCGCCATCATGGGCCAGCAGGAGAGCAGTCTCAGTAGCGCCGGGTACCTCCTTCCGACTTCCCACGAGTCGCTCCGCCATCATGCGTCGCA
TCTGTCATCGCATTCATCGTCGTCGTTCAGCGGCTCTACGCGACGCCCGCGCCTCGACATGCGCTGGAGCCGGCTCACGATGGACCAGCTGCGTGACGAA
GAGTTCCTCACGAAGCAGCTGCGCCGCATGGAGACGCTCCTAGGCGCCAGTGCGCGTCGCCAGACTGCTGCGAGTTCGACAGGAAAGAGCGCATCGCCAT
CATCACTTGCGCCTTCAAATGGCAGTGTGCTGAACAGCCGTGGGGTATTTGTGAGTGCCGCGCCGTCAAGACTATCGCTCCAACAGCGCTTGATACACGG
GAAGTCTGGCTTTTCACCATCACCAGACGACCAAGGCGAAGACGGTGCAGCGTCTGAGAATGACCGATTAGCGGCTGCAAAGCAATTCGAGCTAGCGAAC
GGCATTGGCGGTGGTGATGTCGAGACGGAGATTCGCAAAGAGCTGGATTTGC