Description :
From Genome Similarity Track
Location :
Scaffold_2803:494- 2859
Transcript NameFunction/comments
Phyta_totarag14848reverse transcriptase

Sequence
2365 bases(100 bases per row)
NCAAGCACGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTATGATTACGCATTAGCCCAAGCATCTTACGGAGATGCACTT
TGTGCATCTCGACAGCCGTCTTTCCGTCCACAGCCCGGCTGTGAATGAACTCGTCGTCAATGTAACTCGGTGCGAAGTCGCGCACCGAGCGTAACAAGTG
CGTGACGCACCTGCTGAACGTTGCAGTGGCGTTCTTTAACCCCTGCGGCATGACGAGCCATTCCCAAAGCATACCGCTTGGGGTGCTTACCGCTGTCAGA
GGGATGTCACTCTCACGTATCAAGATCGGATAGAATCCGTCTCTCAGATCAAGAGCACTATAGATAGTACTCTTGGCCATCGAATCGATGATCACATATT
TTCGCGGTATCGTCGCACcgttcagcttgttgtaCGCATGAACGATGCGCCAGCCGTCATCTTGACACAGAACGTCGGCGCACTGTGCGGGGACTTCGAT
TCCCGCACTTGGCATGCTTTGCGACGACTttcgaagaagtcgtcgatcgCCTTGCCTTGTTctcgcggcagtggccactgccgcgtgACACAGTACTTCG
TGCCCGGCACGAGATNCTTCAACTCTTCCGCCTCACACTTCAACCTTTCCATGTCTGAAAGGATGCagatctgctcgatgcgtCCACCGTGCAGGTCGCG
CGCaaagcgcttccagctcatgaCTGGAAGCGACGTCAACTCCGACGCACTCGTTGGGGGACTATCAAGAGTTATGCTCCTGTACTGAAGCCCAGTACAT
GTCTGCGTCAAGACACTCAATCTCTCGACGCTCGACGTCGGAACTGATGTTTGCCCGGCAGACATCTTGCTTAGCGTCTCGGTCCCGGACCGAGACTCGT
GCAGCTTTTTCAGCTTCCACTGTCGTTCCTTCTTGCGGAGCCCGGCTCCGCATGTTCTTCGTCCACGCCCGCTTGACCGGGCAGTGGACGGGTTCGCGTT
ATCATCGCCGGCGGATTGTATCCGCGGGCGCGCTTCTGTTTCGTGCAGCCCGGCTACACGAGAGCTCCCAAGCTGTTCTAGTGCTGGACGTTTGCAACCG
TCTGTACTGCTCGCAGCGTCAGCTCCCGACGCTGACGCGTCTTCGTTACCTCGACGCCGTTCGGCGGAGTTTTCTGTCGAATCTGATCCAATCAGATTCT
CTGTGTCGTTTCCCAGAATCGACACACATTCACTTCCAACGACTTCGGAAGTCGTTGGAGCTTTCTTTATTCACGCCCTGCGCGTCGAGACAGCAGCGTT
AACCGCTGTCTCTACTGGAATGCCGCATGCACCTTGCGGTGCACGTGTCGCGCTGTCGCGACCGAAGGGTACGATTGtacgcttcttccagttcatTTTC
GGGtcatgcccagcaccaagtcgaacttgtcgtctaaGTCTAAGACGGTAAAATCCTCAATAAATCTCTTTTGTTGATATGAGAAGCGTATGGCACGCTT
CTCGTTTTTCACGACGGCACCTGTTGCCAGTCGTACTTTCAACATGCTTCGAGGGGtttgcacctcctcgaagtcaaCGCTTGGCAGAGTCTGCAGTCGA
GCAAAGTTGTTCGACGCACCGGAGTCTACTAAAGCTCGAAGAGAGTTCGCTCTCTTCGAAgacacgtccaggatgacaaGGTTGGGCTTGTCATCTCGCT
TCTTGCAGTGAGATTGCCTCTCACTGGGGGCCGCAGCCTTCATTGACGCGTGTCCGATGTCGACACGCATGACTGCTTTACCAGTAGGGCGTCCCGCGCC
TACTGGTTCCgcgcgtttttttttaatggATCGTAGCGATGccctgcatcgccacgttgACCTCTCTGCCCGTGCACAAGTGCTGTGCACTCACGCGCAA
AGTGACCGATGCGCCCGCAACGGATGCATCGTACGTCAGCTccgcgacgtggtgggtTGCTCCCAGCCGTTGCGTTCGAGAGGTCCATTGGTTCTGGACC
TCCCGTCCTTATCATCGGACGTGTTATCCTTGGCACGCTCACATGCAGTTTAGCCTGCTTCAGGCTAAACTCTTCTTGCATTGCGAATGTgatcgcagct
tcgagagtACTCAGGTACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCCTTCAGACccttcatgaacgtgacgaccTTAGTCGCCTCGTCTATCGGGT
TAGTCACGATGTTCGAGACCAAGTACCGTGCCCTCTGGGCGTAAGCATGGGCATCATACTTACCCTGCTGTAGATCGAGGAACTCTGCCCTCGATCGGAA
TTCGTTTTACGGGGCTCAAACGCTTGTCTGAACTCCTCCTTAAAGGTCTCGTACGTGCTGAAGCA