Description :
From Genome Similarity Track
Location :
scaffold_1334:494- 2765
Transcript NameFunction/comments
g11301.t1 hypothetical protein PHYSODRAFT_497208
g11302.t1 phosphatidylinositide phosphatase SAC1 putative

Sequence
2271 bases(100 bases per row)
GACAAGCGTCCCTAACGCACGTGCAAGCCCGTTTTGAACCGCGTTCAGGACCCCCATGATGGTACTTGCGCAGCCACGGGGGGATGCCGAGTAAATGTAC
TGCGTGCATGCCGCCCATGCGAATCCGAATGTGGCCCCATGCAGGAATTCAAAAGGGAGCGCACCTCAGGCGTTTGCCATCATCGCGCAATAGGTAATCC
GGATCGCGTAGCCCGTAATGGAGATCAGAAGCGCCTTCACCGTGCCAACCTTCTTGATGATTTTATCAGCGAAGAAAAAAGCGGGCAACTCCGACGAGGT
TTGGCACATGACAGCAATTCCAACTATCCGAGGATCACCTCCTGACAAATTGTACAGGTTGAGCGTGAGATAGCTGGCAATCACCCCATACATGAGTCCC
ATTAGAAACACCACGCCCAATAGCACCAACACGTCCAGCTCTTTCGCCACAATTCGAGCGCTCTCCACGAACGAATTCATTCTGGCTGCACTAGGACGGT
CTCTCTCCTCACCATTCTCCAGTGGAGTATCGCCACTATCGTTGCTATATTGCACCGGTGGAATTCGTTTTAAGACGAGCAGCGACGAATACCACAGGAT
CAACTGCGTCCAAAATGACCAGTAAATTCCTCCAGTCACCACCATTAACCCCGTGACGTACGCGCCAATCCCCCACCCTACCGCACCAAAGAGCCGTTGT
TTGCCATACTCTCCCCCAACTTTCTCCAGCATGTTGAGTACTGCGTGGTCCAGCAGAGATCCCGACGGACATCTCTGGAAGCGAGCCATCACCACCATGA
ACAGCGTCCATCCAAACGACCACGAGAAGAACTGAATGCCAAAGTAGAAGAGGGTCCCCGTAATGATGCAAAGGACGTGGATCCGCCGTTGGTCTCGAAG
GTAGTCGGCCACTGCTCCCCACAACGGGGGAGCTACGATGGATGAGAAGTTCGGCAGCGTCTGGAGAATTCCGATCTGCACTTTAGAGAATCCCGCCGTT
TGCTGGTAATAGACAGCGAGGAAGCTGGAGATGGAGGACGATCCGGCGTTCGTGAGTGCGTACATGAGCGTGATCTCCCATAGCGAACGGGGGCCGGAAG
CTGTGAAGGGCATTGTGATCGTGAAAAGTAACTTTTGATGTGCTATGAGCGACGAGCCAGTGACACCCCATCTCAACTGTAGGGAACGACTGATTATCCT
ACCGACGAGGACGGCTGTCATAGCCTTGTCAAAAGCTAACAGGCCAAGGCTGCTGAGATAACACAAAGTCATAATCTGCTGTTCGTTTCTGCTTTATCCT
GTATCGATATTGTCTTAATGTGCTAGATCCCAAACACTGGCAAGCTCCTTTGCACCCCCTACGCCGTTTTCCGGCGAATGTATCCACTGGAGCTGAACGC
TGGCTTGCACACGTATCGGCGGCCGATGGAACGGAACTTCCCCTTTTTGACGATGAGGTATCCCGTCACAGCAAAAAGTGCGAACGTTGCAATGACGCCA
TCACGCACTCGTGTCGCCACCGGCAGCTCCGGGCGCATACTGAGAGAAACACTCACAACCGCGAGCGTAGTGAGTGCAGCCTCCAGCATCACGTTGAAGA
AACTGTGCTGTTGCTGGAAAGTAAACGGAGATTCGTCCCGCTTATCCGGTGTAAAGTTCCCGACCAGCAAGTCGAACGAGTCCTGGCGAACTCCGTCCGA
GAAGTTGTTGAGGTAATAGCGGGTGACCGAGTTCACACCGTCTTGCAGGGCGCCAGCGATTGTTCGTCGTCCGGTGCGAGTGAAATCCGTCTTGAGTGCA
CCCGTGCCAGCATACATCCTGCTTACGTAGTCAGCATTGTCGGCCCACGCATTCTTGAACACGACTTCAAAGCTCGAGTACGGAGAGTCGAGCACGCTGT
CACCCTTGTCGTTGCCAGCAGTATTGAACGGGTAAAGCTGCAGTGCCATGAGCACCGTGCGCCGCGCGAAGAGACTCATCACGACGTTGGTGCGATCCAA
GTTGTCCATGCAGTTGACACGGAAGACGCCGCGCTGGCGTGAAAGCAGTCGTCCTTCGCCATCACACTCAAACCATCCGTACTGCGTGAACTGTTCGTTC
ACCTCCGTCATGAGCTTTGACAAGTTGTGCCATGCCATTTTGCGGCATTCGTGGTGGAAGTCGAACCATATATAGGCAACGGGCTCTGCAAAGAGCTGCG
AGATCGACGTAGGCGCTGATGGCACTGCAATACTGAGTGGAGGTGGAGGGTGCTCTCTTGCAGGAAGCGAC