Description :
From Genome Similarity Track
Location :
contig_61:49398- 50836
Transcript NameFunction/comments
g9185.t1hypothetical protein PHYSODRAFT_490756
g9186.t1hypothetical protein PHYSODRAFT_454443

Sequence
1438 bases(100 bases per row)
ACGCGCAGGCCGTCGTGGTCAAGAAGGAGCCTGTGAGGTACAGCCGCGACACCACGGGGATCTCGTAGTACCATTCCAGCGGATCGTTCATGCTCGTCGA
CGTCCTCTTCCTCAAGTCTTTACGAAATGATGACACTTGGCATTATAGCGGCCCGCGGGCCTGTTTTGTCAAAACCCGCGGGTCGGTCGCCGGTCTTTGT
CAGAAGTTGAAGTGACCACCACTCTGGCATTCCGCGTTAGACAGAAGACCATTTTAGGCAAGAAGCGCAGAGTATGAGCCGCCTGGTGCCATACCGGACG
AAGGTGTCGGAGGACGTGGCAGCGCGCATCGAGCTGACGCTGAACACAACCATGTACCTGGTGCAGACAACGGGCCCCACGTCCTACGTGGTGAGACTGC
TACACGCCTCTTTCCTGGGGCTAAATGAGTGAGTCTTAACGATTTGGTCGCTGTAGATCCAGGAACAGAACTGCGAGAAGAAGCACAAAGTCCTGATCGG
ATCCTTGCAGACCTGCAGCTGTGGCACGGCCGACATTTGCATCCACATCCTGTTTGTGATGCTCAAAGTGCTTCGAGTGCCCGCGACGACGCCCGTTGTG
TGGCAGAAGTCGCTCATTGATTCAGAGGTGTGTGGTGTGTGTGTGTGTGTGTGGGGGGGGGGTCCTTTGTTCTATGGAGGTTGAAGTTTCTGATTGCGGT
GCTGTGGCTGCAGATTGAGATGCTGCTCCGAGGAGGATACAAGCAGATGACAAGACCGGCCCCAAAGCCGTACAGAAAAAAAGAAGGAAGAAGCGGCGAC
TGCGCAACCTGAAGATGCAGACGTGAATAGGCACGATCTGGTGGAGGGGGAAGTTTGCGCTATCTGCCAGGAAGACATGGAGGACAGCCAGCCGCTCACT
TTTTGCCGCAAAGGGTGAGTGGTCCTTGCATTAATTGGTGGCTGTATTCTTTACTTACGTCTTTCGCTGCAGTTGTGGCAACAATTTTCACATCGAGTGC
ATGAAAGTCTTTGGCGAAAGTCGGAGGCAGTCGAAAGAAAACATCATTTGTCCGTTGTGTCGTCAGGACTGGGGCGAAACGGGTCTGTCTACGTTGCGAA
AAGAGATGGATGCAGCGAATAGAGCTCCCAATGTTCATAAAGGTGCGTCGTGCAGGAAATGCAAAAAAAACCGCTTCGGTGTGAGCGTTATCGCTGCGTT
CAATGCAAGAATGTGGATTTGTGCGCTCGATGCTTCAAGTCGAATGCTCACGAAAAGCACGCGTTCGTGGTGAAGTACAACGTTTTAGACTCGTGGGTTC
CAGCTTTGCGTGACAACCAGCCCCGAACAGCAATCAGCTCGGATCTAATACGAGACCTGGAAAACCGAGAACTATCAACAAATGATTATGACGTACTGCT
GCAGCTGGACCAAGGAGGCAAGCACCCTATTCAAGACT