Description :
From Genome Similarity Track
Location :
Scaffold_193:49395- 56497
Sequence
7102 bases(100 bases per row)
AAGACAAGGGATCTCTTCGACACAAAACTGGCACTTTGACAACTTGACATGCAGCTGCTGCTCTTGACAGCGTTGGAGTACTCTGTCCAACGCTTCGACA
TGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGGTAGAGCTGTTGAGCTGGCGATAGTCGTGCACAATACGCCA
ACCCACGGGTTTCTTGACACAAAAAGTTGGGGCACTGAATGCCGAGGTGCTAGGGCGAATGATTCCAGCCTGTACCATCTCCTTCGTCCAATCTTGGATG
ACCTTGCGCTGCTCTGGGCTTTGGCGCCACTGTTTCACCGAAATCGGTTGCGTTCCCGGCTGAAGCTGAATTTCGTGCTCAATCCCTTCGCGGACAGGAG
GTGTGGTACTCGGCAGCTCAGTGCGAAACACAGTATCGCGGTACTTGAGCAAAACATCATATGCCGGATTGTCCACTAGCGCCTCCCATCCTTGTTGCTT
AAAACGCTCAGCCTTTTCTGAGTCGTGCGGGTTTACAACAAAAACAGCTTCAATACCCTTCCCTTTGCGAAGTTCTTTCATAAATTGCTTCGTTGAGATC
AGCTTCGTTTCTCCGAACGCACCGGTGTGGCCATGCTGCCGGTAGTAATGGAATATTTCACGGTTCTGGTTTGCATTCTTGAAACGACGGCCTCCAATCA
TACGTGCGGGAGGTCGGTTAGATACCACCAACTGATGGGCCGGGGGTTCCTCGGTCCTATTACGTGGACGCAGTAGTAAGCGTTCCCCGATGTCAGGGTT
ATTCTCCCGAAGCCACTTCATTCCGAGGAGCACGTCCTTGTCTTCTGGAACAGGCATGACCGTAAAAGTCTCGCACGTCACGGGGAAATTCGGAATCTGT
AGCATCATTTCGACGGTACGTCTTGGTCATTGCACGGTTTGGTTGTATCCCAGACGAACTGTCATCATGTCGTCGGGATGCTCCGTGATTTCCAATTGTA
GTCGCTCGGCTAACGCTTCCGTGACACCGTTGAGGCTGCTGCCATTGTCGACGAAGATCGAAACTTCTGCGGGGGTCTCATCCTGCTTGAAGGCTAAAGC
GTTTACTTCCAAAATAGCATAGAATGATCCGCCAACATAATGGTTCATCTCCTTGGTGGACGTACATTGTGGCTTGATATGGCCGAATTGTCCACAGTTG
TTACATGTGGCTGACTTTCGCCAATCCTCTTTCGGCCCACGCTTCGAAGGTGGCTTTCGTTCCTGTGGCTTGGCCGTACTGTTAGCCGCAGGTTTCACAG
ACGAAACTGCTTTCGACGAAGGCTGATGACTCACTGCAGGTTTTACCGATAGCCCTCCATAGTGAGCAAACTCAAAGTTCGTTGCAATCTCAATGACCTC
ATGTAAGAACCTTGGACTGAGTTCCTTCACCTTCTTTGACGTCTCCGCACGAAGCCCATACTGGAAGTAGAAACGCTTCTCCATTTCCGAAATGTCTAAC
TCGGATTGAGACATCAAATCCTGAAACGACGACACGTATTCATGGATAGTTCCGTGTTGTTTCAGTTGAAACAACCGCTCACGCAGGTTGTATTCAAAGT
ATTTCGGGCGAAAGCGCTCGCGCAACTGTGCCTTAAACAGTTGCCATGATTTCGGCATTCCCGCCGCATCACAATCCGACGAAAAGGCACGATACCAGTT
CAGCACAGACTTGCCTAAACTGCTTGATATCATGGTCACAAAATCGGACGTATCGGCATCCATTATTCCTCGTTTGTTAGCGTAGTACTCCTCCGTAGCA
AAGATCCAAAGTTCCAGGTCTTCGCCAAATTTCCCTTCATACGTGGGAGGATCCTTCTTCCGTCGTTCACCTTGCGAGGCCAGTAGTTGCTGAAAACGAC
TGTTGGCCTGTTGCATTTGCATCTGCAACTGGGTCTGCATCTGATTCTGATACATTTGCTGCTGCTGTGCAATCCACAACATCAACTGCTGCATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCACACAAGCCGATGCGAAGACCCGAAGCTTGATGAGCGCAGTGGCGAGCGCT
CGAAGAACATTTGAGAGGAAGTTGGAAAGTTGAAAAGTGATTGATTGATCCGTTAGTTTAGCGTCGGCGCGCCGCCGCCGCGCAACCAGTAGTTCTTGGC
GACCAGGACACGCAAACAAGTATCCAGGTCCCATCCTAAAGTCTATCAATCTCAAATCCTAGATCAATCCTTTTCTACCAATGAAAAAATACTAATCCTA
TTCGTAGCTTGGCCAAAATTTGTGACTTGCGTCCCATAATCAAAAGTCCGGCTGGAAAACTTGATTGTTGCACATCTCGAGGATTTACAGCCAATGAGGT
CGCGCGAATGTCCATGTTTACGCGTCTCATAATCAAGTTTACTTTTGACACCAGCCAATAGGATAGCATATAATGAATATAAACCATGCATCCCCGTATT
ACGCTGTCCAGCGTAAACTGAAGTGCTGTGCAGCAGCACTTGACGTGGGAGTCCTCTGCCATCTCATTGGCAGACGGACGTCCACGTCACATAAAATGAC
CCCGTGACTGACCCCGAAGGCCTGCTGGATGTCTTTTGGGTCGGAGTGGACTCGGAGGCTTGGTGGGTATGTTCCGAAGCTTGGGGGCAGGTGGTGATCA
TTATGGCAAATCTTGGAGCCTGCGCGCGGCAGACATCCATGGCAGATTAGTAGCGGCCCCTCACAACAGCAAAGACGCCGACTTCAACGCTGGTACGCTT
TCCAGATCGGGATCGAGTGGGTCCATTTTTTATATTCGGCTATTTTTTCAAGTTGCTGTATGTATGTTGTTTTTCTCCAGCCAGATACTGAATTTTAAGA
GCTCTTCAGAAGGAATATATGGTGGCACATCTATGAGAGCTTGGAGCCGTAGCATTTCGGCTACATACGTAGGAGGAGGTTGGAACTGCTGCATGTATTC
TTGTGTGATATCTTCGGTAAGTGTTAGATTTTGCAGTGATGTCGTTCGTGATAGTGCAACATAGAGAGTTGATGTGGCATTCCTGGTCTTTCTAAGGGCG
TTACCGTAACGCCATCCTTGCAGGTTTTCCCTTGTAGTTTTTCAGCTGTGCAGGAGAAGGCTGACACTATTGCAAATTGACGAACTGAAATCGATGAACG
AGCTAGATTCTTGAATTTTGACAGCTTAATCTGTGCGTTAAGAACTGATATTCCGATAGTTCCCGGAGGATATCCATCTACCAATGTGCTTTCGCAGTCG
TGAACGCGAATGATAATTAGGTCGGGGAGGGGGGGGGGGTTAAGCACCTCTTTTACGATAGTGCCATGAACTAGTTTATTACGGCATGCAGATTCTTGTA
GTGGAGGCGCGAAACCTACTATGATTCCGGTTGGTTCCATTAGCAATAACGTTTGCATCTTTTAGAGCGGGGTGTTTTCTTGTAATCATTACTGGCATAC
CAATGAAGCAGATTAATTTCATTGGAATTCGGTCAGTTTCATCGTCGTTTGCGTTAACTATTTTGTTGAAGATTGCCTTTGATCGAGGTGTCGGCTTTGC
CGAGATTTCGTATATCGTAGTGTTAGTCTTTGTACATGCTTGGATTGTCATTGTGTCATTAATTGCACATCGTAGTGCATTAGTGGCGACAAGAACAGGA
TTGTAATAGGAATCCGGAGAACGACCAGCTTTACTCACTGAACGTCGCGCGTCTGTAAATACTCTGCAGTTTAATAATTTTCGGTGAGCGTCTGATAGTC
TACCCCATCGAAGTTCACTCAAAATTTCTGCGTAGATTGGGTCGATTTTGGCACGCATATTTTCGGTGAGAAAGATGACAAAGTTGATGGAGTTGTAGAC
TTCTAACCCAACATTCCTAGCGGTGCTTGCTGCTAGAGGTGGAGGTTTAAAGCCTGCGACCATGGGAATGATATGAATTGCCAATTAGCAAACGAAGATA
CTAATAAGAAACTGGTTAGAACTTACATGGTGTTCCACGTACAGGTGGTAACTGTAACCAGTCACCAAAGTACATGGCATGCTTTCCGCCCATTATTTTT
TTTTTTTTGTGGGGTTGATCGGACATTGCTCGTGATGTCATGTCAGCGGAACCTAGTAACCCTTGATCTGTCATAGATATTTCGTCCATTATAACTAATA
CCACCTTTTGAAAAGCATTTTTCATTTGCAAACTGGGAGGAGAGTTGGATTGTGTACCGTTTAGCTGAAGGTTGCGTGCGGAGTGTATTGTTCTGCCTTT
TATATTCATTGCCGCCACTCCTGTAAAGGCAAGGGTTTCAACGCTTCCTTCTCGACCCCACTTCTCGGCAAATAGTAGTAGTGCGAAAATTACTCGTGAT
TTACCAGTACCAGCTTCTCCGACGTACGCTATAAGCTGTTCTTTGATAGCATAGGGCTGCAAGACAAAATCTTCTGGAAATAATGGTACTTGTAAAACAT
CTTTGATATCTGACAAGTATGCAAATAGGAGATGCCTCGCTGCAATTTCAAATATCGCGTGCTGCCAAAAGTTGAAGCTAAAGGACTTTGAGACCGTTTC
AATGCTAGGAAAGGCAGGTATAGATATCGGCTGTGGCTTGATCAGGCCCCCAGGGAACTGCTTCGAAGCAGTCCTGGAGTCTTTCTAATCTTGTCTTGGC
TTCAGGAAAAGCTGCAATGAAATCGCTAGTTCCTGTTGATGTGTTATTGGTAATGTTGTATGAAGTGACATGTTCGGTGTAGTCTTCGAATGATGTGTAA
GCGGGTACAAAAGCCTCTGCTGGTTGTGAGTAATTATCGCATGTGTTGTTGATTGTGGAGCGCAAATTCTGAACTGCATCAATAGGACACGTGTACAATG
TTTCGCTGATTAATTGATCCACGTATGTTTCTAACTCGTTGTCGCTATTATCGCCGTCGCCACTTGTCGCATCGGAAAAGTTGTCATTGTCTATTTCTGT
TTCTCGATCGTAGGGCTGCCATGGAGCTCTCGAAGGAGATTTTTGCGAAGCAGAATGTCTTCTTGTGATTCTTGCTCTTCTTTTTCTATAGCTTCAGACC
TGTAATAATCTATCCACTTCTCTTCGAATTCCCTCATTTGAGTTTGTTCAAGGGCTGAGCACGTGGATTTAAACCCAATGTAAGCGCGTTCAGCGTTTGG
ATACCCTTCAACAATTCTACCTTCTCGATGTGGTTTAAAAAGTGTCAAAAGCACCAAATAGTAAAACTTTCTGTCAGTATCAGATGTGTTAGCGTTAAGA
TCTGGCAGTTGCTTTCCTGACATGATGAAAAGTTGCCGATGTGCATTTTTTTTTAAAGTGTAGCGCCCCATCGGCGTCTTGTTTCTTTCCGCTGTGGTAC
CATTCACAAATAGTGATAAAATTGACGTTATCTAACTCTTTTTGTCGTTTCCAGTACATACTTAGCTTGCGTTTACCATTCGATACGGGTCCGTTTGAAT
CCGAGTTAATATCTTCGGGGATCGTAATTTCAACTGTCGGTGAATTTGTACTCTGTAGCATCTTTTCGAGGTTCACATACGTATGTTCATGTGAGAACCA
AAATGGACTACCGCGATGAATATATAAACCGGCCATTGGTGCTGCAACTTCTTGGCCGTTCGTCAGCGCATATAGCATAGATGAGAGCAATTTGTACCCT
CTCCGTTCTGCAGTGTGATGGGTTGACCGATCTGCTTTTTCCACAGCTTTGTTGAATACACCAACTGAAAAGCGAACTTCGTTTTCGATGGGATTTTGCT
TTTTCATGCAATACTTGCAAATGTATGCTGCTGCGTTTTTAGCGCTGGCTCCAAGCACAAGCTGCACGTCGTGGTTTCATTTTAGCGTTTGCATTAGCGT
TCGATTGTATGCATTTACGTACTCTGATCCAATCGGCCGGCTCAACTGCAAATCGTTCCCGTCGTCGATGCAAGTGTTTTCTAGTCTAGGTTCATGCGGC
TTAAAGGAACGGCAGACAGATGCTTTCGGTGTTCTGCGCGTAGGCTTAAAGCAAGCATTTGCGTGGCTCCAATAGTGAACTTGTACATCGCGGACGATGA
GGCTTAATTCTAGTGCCGACAATGAGCTATTATCATTATTACGCGGTGGGGAGCATCTAATAAAATCAATGTTTTCAGGTGATAACTTTACTGCATTGCG
ACGCGCAGCAATATCAATCGCAGCATTAATCACATCTTTGTCTCTATACTTGACATTACAAATCTGACAACAAGAAGTAATCGGTGCATGTTGTCCTGGC
AATGGCTTCCGGTATCCATCGATACCGACCGAAACTGGTTTCAATTCTCCAGCGTTCTCATTGAAGCAACGATTTGGTGATTCAACCACTGAGATAGTTG
TTGTTGAAATGCAATAAACATAATCGGTTAGACGCTGTGTGAATGCTGCGTTCGAAGATATGGCTTCTTTCATTTGCTGTGACGTGGTAGGAAATCCGTG
TAACCATACCGCGAAGTGGGCATGGAGATCACCACCCTGTTGTGTTTCTGCGGCAGCCCCAAATGCTCGAACCACACCGAAAATTCCCCCTCCTTTCTTG
GGTTGATGTGTCTTTCGATCCCACCCAAGAAAAACATCAATTATAATAGTCATTATTCTGTCAAAAAATAAGGCGCACTGCATTGGGTGGTTGTTGGCAA
TGCGCTTCCGATCAGCACGGTTTGGTAAAAGACGCATGTTGGCTTCTTCGATTACGTGATGCGGTAGTACACCAGATTGTTCAGCAATTGTATAAGTCCC
AGCGGTATCGGGTGATACCGTAAAAAATAGCTGTAGTGGTCCAAAACGTTTAATATATCCGAAAAGACCGTGTCGTGCTCGCATTCTGCTCAAATTCGAT
CCATAAAATGCTGTCTCACTGGTACGAAGACCTCTACGTAGGTTAATAACCTGTTGAACCTCTTTTGGGGGTGGATTTGGCTTCTTTCCATGCGCTTCTG
CTGTAACAACGTGGGCGTGGTATTCCACGGAGCGACGAATTACACCACGGGAGATCAATCCTGCTTTTAACGCGTCAGATGACACATGAAGTTTAATGTG
CC