Description :
From Genome Similarity Track
Location :
Scaffold_1059:4939- 6497
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1059-snap-gene-0.5LMBR1 domain-containing protein 2 homolog A

Sequence
1558 bases(100 bases per row)
CGTGGACGACGTGCATGTCCTTGAAGAGCGCGGCAAACGCTGTGTCATCATCACTGCGATTGTGGACCAGCAGTAGTACGTTGTACGCGATCACAAACTG
CAGACGACACTGGAAGATTGCGGTCGCGAGCAGACTTGCATCCGTCGAGTTGTGCTCGCTGCGCAATGCGCATTTGCTATATCCGCGAAGCGTTATGAGA
CCCGCGTAGGCGCAGGATGCGACATACAACAGCACAAAGACTACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGAGCAGCGACAGTGACGACGAAGAGCTCCAGCCCAAGGTGAGCTCTCCCCAGAGGATGCACACTGAGGCGCATCCTGTGACCAC
TGCGCAGCAAACCGCAAGTGGTACCGTNNNNNNNNNNNNNNNNNNNNNCGTGATGCACACGTTGCGTGCATGGTTGAGCAGCGGGGTGGTCGGGAACAGA
CTCGCAGGCGGCAGTTCGCGCGTCATCGCACAGTTGAGGAGACGATCGGTCTCAATGCAGACCGCGAGCCAAGCGTACTCGGAGCGGCGCAGCTCCGTGT
TCGCGAGTTTGATCCGGCGATGCAACTCGACGACTTCACGCAGGGTCGGTGCATGCGATGACGACGTGAATGGAGATCCCGTGACGGTCGTGCGTCGGTT
GTTGGTCTTGCGGTCGCGCTTGTACTGCTGCCACGAGCTGCCACCTACGGGTGAGGCGGCTCTGGAGGTAGCAACACGATCACTGTGCTCGACGAGTTCT
TTGACTTGCAATAGACACGTCTTGACAAACTGCATATCGCTCGTGAGAATGATCGACACACTCTCAGCGTGTAGCATGCGCTCGTAGCAGTCATAAACGG
CACCAACTACGTCGTCATGGACGAAGATGGCGTCCGTGTACTCCTCGTGGACCTGTACCGCGCGAAAGTGCAGCGCCTTCAATTGCGTCTCAGGATAGCG
GAGCATCCAAAAGCGACGTGGGGCCTCGACGAGTCCGAAGCCAAGCAGAGCGATTGCCCAAAGCAGACCGTATGTGTTGCTTGTCGCCATGGCGAGTCCA
AGTAGCCCATCAATTGAGAAATTGTCGACACACGCCAGATACAGCATGGCAATACCCACGGCAGCACCGATGATCCTCCAGTGGAACACAAGCCGCGACA
CCGTGCTCATGATGCGCTTCTCCAGAACAAACTCGCCATTCTGCCCAAACTCGACGAGGAACGGCAGCACGAACCAGCTCATCACAAACGTCATCCAGTA
GATTGCCTGCCACGCCACCAGATACTGCGCTCGCTCTTCATCTTTCTCTGTGTCTCCCTGTGCTGCTTCATTTGATGTGGAAAATGCATTCTGGACCAGA
TCCACGGGGAGGAATAACAATGTGAGGAGACCGAGCGTCCAGCTCACGAACACGGTGCCTTGCACTGTCGTGTCCACGTGCGTGTCCTTGAACTGTCTCA
GTACCCGCCACACGAACCAGAGCAGCGCCGCGAGTGCTGGTAGCAGCAGCAGCATCGC