Description :
From Genome Similarity Track
Location :
Scaffold_157:49382- 54395
Transcript NameFunction/comments
Phyta_totarag4777hypothetical protein PHYSODRAFT_261139
Phyta_totarag4778hypothetical protein PHYSODRAFT_476855
Phyta_totarag4779hypothetical protein PHYSODRAFT_309966

Sequence
5013 bases(100 bases per row)
CAAAGCCCTCGAGCTCCTGGCTCTTCCGCAGAGCGCACTTAATTACCGAGGGAGGGAAGCCTGCCATGGAGGCCACGTGGACACCAAAACTCTCCATGCA
TGGGCCGTCACGCACCTGGTACACCATAGTGATCTCTCGGTCGGTGGCCACAGCCGTGACGTGTTTGTTTGCGAAGCCGTGGGGGTGTTCCTGCTTCAAG
GCTGTCAGCTCGTGGAAGTGCGTTGCAAAGAGGCACATCGAGCGCGCCTTGGTGAGGAGATACTCAGATATGGCCCAGGCCAATCCAAAGCCATCGTACG
TTGACGTTCCTCGACCCAGCTCATCAATAATCACGAGCGAGCGTTCCGTGGCCTTGTGCAGGATGGCTGATGCCTCCAGCATTTCAAGCATGAACGTAGA
CACGccccgctgctgcaggtcACCCGCACCAACACGAACCAGCAACTTGTCGAATACAGGCAATTGAGCGACTTCAGCCGGCACGAAGCTACCGATTTGT
GCCATCACTGCAATTGTACCCAGCTGGCGAATGTAGGTACTCTTACCACCCATGTTTGGCCCAGtcacgagctggaagcgtGATTTCTCGCGCTCAAAGT
TGTAATCATTCGGAATGAAGTCCACACCGTCCTGTAGTTCCACACAAGGGTGGCGCGCGCTTGTCAGAACGACACAGTCACCATTTTGTTCTAGCGTGGG
GCGGCAATAACCAGAGCCAGCATGGCATGCAGCGTGCGCGAATCCAAGTAGCACGTCCAATTTTGCCAGTGTCGCAGTTGCGGCTTCGAGTACAGGCACA
TACGTGCTGGCCACGTCGATCGCTGCGTTCAGCAAATGAGCCTGCCGTTCCTCGTATTCACCGCGCACACGGCGGTAGTCCGTGGCGAGCGCCTTTAGCT
TAGTCGTCGTGAATTGCACGCCACTCACGAGTACCTGGCAGATGTGCACGTACGGCAGCTTGGACAGGCGTGCTTCCTCCTTTTTGTTTACAACACGGAA
AGCAAAACCGCGAACCTTGTCCTTTTCGCACTTGATCTCACCACCGATCGTATCAAGTGCGCTACggtgttcttcttcaatgtCCGCAAGGATTTCGTCC
CATTGCTCACGCAGTGCCTGGAGATTCTCGTCGTGCTTAGCGTTCACCACAAGAGTTGGGCGGCTGTCCAGGTCGACAACCTCCTTGACGAGCTCCGTGT
AGCCTTGCAGGTCTGCCAACACCTTCTTCAATGGAGCGGCAAAATTTTCCTTCACTAGGCTAGCAAGCGCTTTATCACCCCCAGCCTCCACACTCTTCAA
GAGCTTCAGGACACGTGGCAtgacaccaacagcagcatcgtaCACGCTCACTAGGTCCGTAATCTTCGCatgcttcttcttttcaaGTCTAATGGCCAGT
CGACCCAAGTCAGGTAGAGCCTTCATacactcgtccagcagctccatcctcAAGGACGAGTCGTCCACAaagagctgcacgagacTCTGCCTCGTCTCAA
TCTGCTTGacatccagcagcggctgtcGGATCCAGCGTTCCAGTAGCCGTCGACCCATGGGCGTCTTCCCTCGATTCAGAATCTCCAACACACTGCCTCC
GAATCTCGACACTCCCATCGTCGTGGCGCTCGGCTCCGGGAGCAAGTTCAGCGaccacacagcagcactatcaagctgcagagcggaCGAGAGGTTCCCC
TCGCTCAGCGTGTAGCAGCCGAAGGCATCCGCGTCTGTCATGACGCCCAGTGCTTCGATCAAACAGGCCAGAGAGCCCGCAGCCAGCTTGGAGGCCAGCA
CGTCCTGGTACTCGGACATCGTATTGGCTCCTAGCAGCCTAGCGACGCTGGTCTCGACACCGCTGACGTCCTggaacagcttcttcttcatgtagTCCCG
GGCCACGTCGTgggtctgcagcagcgcatgcagcttcttgctATCGCCCACGACCTGCGTCTGCTTTAGATCCGCCGACAAGTAGCACGTGGAGGGcgcc
agctgcaccagcagtgaCTCGAGGTTGGCCAGTTCGCTCGAGTcagagaaggagaagagcagcagctcccacTGCTTGGTGTCTTCATCTGCCTGGCCCT
TGACGCACGACGCACGCGCGCGAGGACGTCGCACCGCCACGCCCACTTGTTTTAGATGCTTCTCGTTGCggatctgcagcgccacctctGCCTGCGCCaa
ctccagcgtctccaggGAcgagtcctcgtcctcacGGTCATGGTCACCCATGTCGTTCGTTGCCAAAATTCACGAGTGATTGTCAAAAGGGCGCGCGCTA
AATGCGGACTTCCCGCGCTTATTGTGTCCTGGTTAAAGTGTCCCTTTATGGGATAACTACCAGCATCAAGTTGCGTTGATTGAGACCCTTTTCGACCGGA
CATGTTCGAATTTTGCTGTTGGTGagcacaacaacaatggTGACGGACTGGCGAGTGGAATAtgtgaaggcggcggcgctggaggaggaaggaaGCACCT
CTGCGTCTGCTTCCACCTCGCAGCAGACAAAAAAGACGCCGGTGGATAAAGTGCTGGCGTTTCTGGACTTGTTGCTGACGCAGGAAGGCGGCGAGTGGTG
GATGAAGCTCCGTCATCGAGTCAAGCGTGCTCCGAagaagagtgatggtcaagacgtcaagacgctggctgaagaggacaagaagcagctgaatACGCTG
AAGAAGCGACTGGCTGCAGTGGGGAGCgagttgctgatgcagctgcCGGAGCTGAACGCGTCCGTGAGCAGGAAGGAGACGCCGCGCTCCGCCAAagtgc
gagtgctgcagctgcaattCGTGTGCCGCATGCTGCGCTATGGAGTGCTGAcaaagaggaagaaggaggagaagaagcagctgaagaaggagatccGAGG
ACTGCTGGATCgtgtggcgctgctgttggatGCGGCTAACCCGCCGTCATTGGCGGATGAAGACGCGGACGAACGCTCGCCGTTCCAGGAGTTCCTACAA
CAGCAATTGGGTCCGAGactgcagatgctgctgccggagctggtgcagtATTTGCTGAGGGTATATGAGTTGGAAGAAGAGACCAAGGCTGGACAGGACA
TGAAGGATGCGATGAACGCCAAGTTGCCTACGGTAAGAGTTTGTGGTCGGTAGCTTTATTTTGATGATTAAGTTGTTTTTACTGATTCCCGCTTGTTTGG
TCTTACTGCTGTTCAGTTGCAGCCCGTGGTGAAGCCACCTCAGCCTCCCGCTGAGTTGCCAACCTCTGCCGTTACCGGCAACGGGAGCATTTTGTCTGCT
TTGCGCCAAGAACGGCCAGCAAAACGCTCTCGCCCTGATGCAAGCGAGTTGTTCAAGGAAGTCCAACTCCCTCATCaattgcagcagaagcaaaTGCAGT
CGCGGCCTCGGAAATCAAGACGGGTATCGAACagtcgtggcagcagcgcaagcaaAAGCAGTAGCGCTAAAAGCAGTCAAGACACACTGCTTCGCGTTGT
AGCCGGTGCGAAATCGATGCACAAAGCGAAAACTCTAGATTTTGCAGGCACGTCAAAGACTCGCTTAGCGTCGACCAGTAAACTTCCTGGTGAGACTGAC
TTGCTACGTCGCGCCGCTAGGCCGTCCAGTGCGAAGGCACCTACAGCACATCTCCTTCACAGATCGATGTCCGAGCGCTCCCACTTCGCTGGGCTCCAAG
CTACAGTCTCCTCGTCACCAGGCACTGCCGCCCAAGTTGgccgaacagcagcaacaggaagaaCTCAGTCACCATCAACGCCTGGAGCTGCCATGCGCCG
AGCGGTAAGCACTTCATCAGTGGTCATGCGCACGCCGGATAGACCGAAGCGGTTGGCTGCGCGAACTACCAGGAGGGTTTTAGTAGAAGCATCTCCTCCA
CTCCGCAGGCCAAACGGCGCCGGAGCTTCTGCACCTCGTCTTCTCCAGGCCAAATCATCTCGCCCAGGTGTCAACCCTCCTCCTCTTTTTCGGTGATACT
ACTAAACTGTTCATCATACAAGTTGAGTAATAGACAAAGAAGGCGTCTAATTAAGTCTATATTGTGCCTAGTCATCATTTGCTTGCCGTGTCACCGTCGT
CGCTatcactgtcactgtcactgtcgCTACCGTACGACACAAGCCCAAGCGCTGCTGTATTCGGCTTCTCCTTTTTAACCACCAGCGCCTGACTCGAGTC
CTCGaccttctgcttcttctttaGCGCTTGTTCCTTGGGCTTATCAGAAGACTCTGAAGTCTTGGAATCAGCTTTGCGCGCCTTATTGTTAGCAGCCTTT
CGCTTGGAtttcaccaccaccaccgcagtcttcttcttgcttgcCGTCTTCAAGTCATTTTTTGCCGGATAGTGTTGCAAATGTTGCGCTGTAAGCGgcg
cgccagcagcagctttaGGAGCACCACGTGCCACCACTACATTAACATCCAAAGACAATACCGTTAGCAAGCAGAACCAACACTACCGGTAGCCCAACCT
AGAACAGCTCTGTAGTCCGTACGGAACTGGGCGAGGTCCTCCTCATGCTGCGCCTGGCGCTTTCGCTCGatgtcctccttcttggttTCTAGGTCCTTAA
TGTACTCGAACTCCTCTTCATCCAATCCTTTGGGGGGAGCTGTGCAGTTGCCACAAAATTGTCAATGCCATCCGTGAGATCCAGGCAGCAGAATTCAAGC
CACCCACCAAACGGGTTGTTTTTCTCCTTCCAATCGCTATCCTTCTTCTCTCGGcactcctgcagctgctcgtacAGCGGCTTGTAGCCTGCTGCGTCCT
CTGCTCGCGGGACTGGAGCCTCCGTCACccgcttctcctccacgttGTCAccgaagagctgcagacacGAAATTTGACGGACAATTCAGCGTCAACGAAG
AGATTGCAGTATGGTGCTACAGCGTATAAGTGCACCAGATATGACGCACCCCATCGGAAGATGTCAGCACGGATGTGGACACGAATCCCGCCAGAGACGC
CCTCGGGACACCG