Description :
From Genome Similarity Track
Location :
Scaffold_57:49382- 50718
Transcript NameFunction/comments
g7949.t1hypothetical protein

Sequence
1336 bases(100 bases per row)
AACACGCTGCTCATGGGTGCTGCCACAAACGTCTCGCCCCAAAACTTCCTGCTGAGACATAATTCATGGTAGACATTTTAGAAACAGGCATACATGTACT
TATCGATTCAATGTATTGGCCTACACTATCAAAAATATGTTAACCGGTAGCCGATAGCAAGACCTAGGTGTCAGATGAAGAGCTGGCGCTACCACAAGGG
TACGCCACATAGACCTGGATGACCACCGTCAAATGTGTGCACAGCTACGATATGAGGTCATACCCCCCTGTATTTGGATTGGATGCATGGTTGACGTTTG
GACAAAGAGAGTATAGATCTTGCATGTGTATATATATGACAGCGCGGCTACGAGGGCTGCTGCAGTCTGTACGTATAGATACATTGAAGTTTTGTGTCTA
TCCTTTATATCTGCGAGTACTTCTACTGAATACACAATGCATCAAGAGCGGCTATGGTGCTGTATTACTTGGCTTTCTAAAGTCTACACTTCAGAATCAT
CCGACTCAAGCACACAACGCCTGCCACCCCCCGGCTGCGGTCATTTGCCCAGGTAGCGCTTTCTTCGACATTCGCTAGTGATGGTCGCTACAACTCGAAG
CAAATGCGCTCAAGCAACCGATTCTAGTCCCCAGATTATGAGCCCAAATGATGCGCTGGAAGGCACAGGTGGCATAGATCAAGTTGTTCCAAGAATGGCC
GGTCATGCCGAAGAATCAGCTTCGCGTAGACCCGGGCCACTCAACCTGTCGGAGGGACCAGCTATTGCTCCTGTCTTCGCAACAGAAGGCATATTAGTGA
CGGAAGGGGATACGTCACCGTCCGCCAACTCAAGGCTTGATATACCAAACACTATGGACCTGACAGGGCGTCCGACGTAGGGCTGAGCCAGCCAGCAGCG
GTAAAATCTATCTGCCAATCAGGCGGCTCCTGCGCTTGCAAGCTTCAGAGGCACTCTCTTGGATTCAGTCACGTCACTGCACTTGGCCCTTAGCAGCTTC
TGACGATATTTCTGGATCAAGTGAAGCATCGTGCTAATGCCCACGCTGCTAGTGGGCAGCAAAATGCCTCTGGTGGGCAGAACCAAGGCTTTCGGATATA
GCAGCCAGCAATGAGTGTCAGATCTCAAGTGCCAGTTTAGGTAGGATAGATGAGACAGCTGCTGTCAATTCCACGAATTCCGACCCGGCCCTATCATGTG
GGGCACCATCATGAGCGGGGTCTGGTGTGTGTATCGTCCAGCACATTCTCTTCGTCGCTTGAGCCGGATTCGAACTGGCCGAGGCCGTACGCGGCCGCAA
GAGTGCTTGTCGTGGCGGCTGCTAGCGCTTCCCCCG