Description :
From Genome Similarity Track
Location :
contig_9:493760- 495317
Transcript NameFunction/comments
g2812.t1hypothetical protein

Sequence
1557 bases(100 bases per row)
GACGGGGCTCTGCGTGATGGCGGCATGCCCGTGCTGACCAGCAAGGAGAACCTCGGTCTGCTCTTCCAGTACGGTGCAGTTGGGGTCGTGTACGGCATGC
TGCCCGCCACCATCTACCCGTTCATGCAAGAGTACCTCAACTGCTCCGGATCGCAAGTTACCGCGGCCGACCAGCTTGTGGTGCTGCCTTGGAGCTTCAA
GGTCTTCTACGGTATCCTGTCCGACTGCCGACCCATTTTCGGCTATCGTCGGCGGCCGTACATGCTCATCGGCTGGACCATTTGCATCCTCATGCTGCTG
GTCATGGCTGTTATGCCTATCGGCAAGCCGTACTACACTGTTTCCTCCGACCGCGACGTCGATGTTTCGGACTACACACCGGATTGAGGCGCGGATCAAC
TACGACGCACCGTCGGAAGGTGCCAAGTACGTCATCCTCATGTTCTTCGCCGCGTTCGGGTATGTCATGTCGGACGTTTGCGCCGACAGTATCACGTGTG
AGCTGGCGCAGCGTGAACCTCTCGACAAGCGTGGCAAGACGCAATCGTGCATCTACACCGTCCGCACTATCGTGGTTATCCTAGGCGAAGTCATCGTTGG
GTTCTGCTTCAACGGCGAAGAGTACGGCGGCGACTTCGACTTTTCGCTGAGTTTCCCTCAATTGATGATCATCATGATGGTGCTGACACTCCCAGTCCTC
CCCATGACGTGGTTCTTCATCAAGGAAGACAAGTGCGAGGCTGCGAACTTCCGCGAGTATATCAACAGCTTCTGGGAGCTGCTCTGCAGTCGTGCGGTGT
ACCAAGTGATCGCGTACATTTTCTTTAGTGGCATCTTCGCGAACGTCACGTACACTGCTAGCTCCCCGGTGCAGTCGTACATGGTGGGTGTGACGCCCAT
CAACAGCACACTGAGCGACATCCTGAGCAACCTGCTATTCGCTGCCGGTATCATGATCACGTCAAAGTGGGGGCTACACTGGAATTGGCGCTTCATGATC
GTGTTGACCGGCGCCATTGTCATGGTGGTGGACTGTGCGTGCTCCTTGATCACCGTGTGGGACGTCTTCCGCAGCCAATGGTTCTGGCTCGGTCCGCCGA
TCGCCGTGGAGCTCCCTTACGGCATCGGGTGGATCATTTCCTCGTTTGTGACGGTCGAGTTGGCCGGTCTTGGCAACGAAGGCGCCGTCTACGGTTTAAT
CACCACGGTTAGTAACATCGCCTCTCCGTTTGCCACCACCTTGACGCTCTTGATCGACGGTCCGTTCGATATCACCAACACGCGCGTGCAGACCGACGAC
CACTCGGTTCGCTCCGACATCACGTACACTATCATCATCATGTACGCCATGACGGTTTTCTCGTGGGTCTTCCTCTTCCTGCTACCCAAGCAGAAGGCAG
AGACCCAGGAACTCGTCCGCAAGGGCGGTCACAGCAAGATCCTCGGCGGCCTCACCGTCTTCTACTTGATGTTCTCCCTGGTGTGGTCCGTCATGACCAA
CATCTTGGCCATTTTCGACAGCACGTCCTGCCTCGTGATAGCCGGCGGTACAGGTTG