Description :
From Genome Similarity Track
Location :
Scaffold_247:4936- 6238
Sequence
1302 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAAGCTGGCATGGGACCCACTTCAAATATGCGAGTGCATACGGAGCACTACCGCCTACCGGTACGAGGCGGAGGCACTCGCTTGAAGCCACG
CTGTACCACGGAAGCTAGAAACTACTGCTACAGTAGTATCTAGTCTACTATGGAAGGGGCATTTTACTGATGCCAAGGTGTTTCGATGCTCTGACTATTT
CTCAGATATGCACACAGCGGCACCCATTTTCGTGACAGGAATTATCAGAGTATGCGGTCGTCTCGACGCCTCATCAATTTACGTCCCTTTGTACCAACAT
GCGAGCAGTGCATGACGGCACAAGGGTACGAGCAGGAACTATTTACATTCTACTGCAAGGTGGTTCTGACACTGCCATCATCCCCATCATATACCGGTAC
ATTCATCAAAAATGCACGAACGACCAACTTGTCGCTCGCTGCACGAATGAACCTGGACTGTGCAATATGTTGCTCTGATCTCGTCCGTGCAGCACGTGAC
GACGTCGGATGTTTGCCTCGACGTACTGTAGTATCTTTCACCGCGACTGTGCAGCACGCTCAAAAATACCGTTGAGTACGTCACATCAACCCAAGTCGTT
GCTCAAGCTACACCGTTTTCGTAGTCATTGGTCGTTTTATAGCATTCAAAATGGCAAGGTCGTCGTTGATCTGGTCATACATGCAACGATCGACGGGCGA
TACCCATATCTTTTGCACTGAGTAGCGAATGAAATTTCGGGCTGCTAGGCGGCTCTCGTTTTGCACTTCATTTTCACTTTGACCTTCTCCATCAACATGC
GCATTTTCCTCGGTGCCCTCCTCCTTGCTGCTACGGCGTTTGGCGCTCAATCCACGCCCGACGACGCCACCGTGGCCGTAGTCGATGACACCACCGTGAC
CG