Description :
From Genome Similarity Track
Location :
contig_161:4935- 28135
Transcript NameFunction/comments
g13947.t1hypothetical protein
g13948.t1OWZ00441.1 reverse transcriptase, partial [Phytophthora megakarya
g13949.t1hypothetical protein
g13950.t1hypothetical protein

Sequence
23200 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTCATCGACAT
TCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGA
GATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGAT
TGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCC
AGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAG
GGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCG
AATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGA
ACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGG
CGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAG
TCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCA
CCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTC
GGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGG
GCGGCGGAGATTCGTCTCCGGCACTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTGCCTCGTTGCTCGGCTCTCAGC
TCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCT
TCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTAC
TTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCCCCGATCCGGTTCAGCTCGACCAATTCT
AATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCA
AGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTG
GATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTT
ACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTATCCACCGTTCTTTT
CGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCC
TTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTG
ACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAA
AACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTT
CATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCG
AATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCCGGCGAAGCTTCGTTTGGCGCCGAG
AGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCAC
CGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGGCTTC
GTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAACGTC
TCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGCCGGTCGAACACCGGCACCAACGAGGATTCATCCGGTTCTCCGG
TGGAGAATGTGGTGGAGTGGGATCGCAAAAATGGATGATGCGATCCAAACTCACCAGCGGTACGCCCGGACTGCCGACTTTCGGAGGGGGTACTCCGTTG
ATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGAC
CAAGGCGGAACTTGTTGGAGCTGAACTGCTCCTTCCGGGGAATGGGGGATGACAGCCACGCGGGTATCCTTCACGCGGTCGTCGGTTGTTGGTGATCGGG
TCTTGGGGTAAGTCGATCACGTGGGGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGAT
GAGATTGTACGATCGCCCCCTGGCCAAGCTATCCAGGTGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCTTC
CCCGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCG
CTTGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCACTG
TACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTGTGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAGTGTCCGGAT
GATCGACTGTACCGAAAGGGTGGTACCAGGCAGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCAC
CAACCCCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCAATCGCCCCCTGCTCTGCG
ACCAGCCGTACGGCGGTTGGTCTCAGCGCATTCCGTCGCAATTCTGCTTCTTTCTCTGAGCCACCACCATTCTCCGTGCTAGATCCAATCATGGCTGGCG
CGAATGATACTCCACCCGAAGACCATCCCGCTGTCGCGTCTGGTACGTCCGCCGGCCGTACCTCTGAAGCTCCAGTCGTCCCCACTGCTCGTGTAGCGCT
CCCTAGCGTCGACCTTAGCGCCGCCCGAGAGTCTCTTGCAGTATTCTCGTCCCTGATGGAGCGTATTGAGGCCCAGGCTGATCTCAGTGACGATCACGCG
GTATTGCAGCAGGCATACCGCGACCAGGTGGCGCGTGCTGATCGGTTTGAGGCCGATTTGAACGCTGCGTACGCAGCCGCCTCTCCGTATGTACTTTACT
GTCAGCATCAATACGATCTCCTATTCCGGCGCTATCAAGAAACCCAGCAAATGGCGGCCGACTTTGAAGCGGCAGTGCGCGAGCGTCTCGAAAATTCGCA
CGAGATCGCGGCCATGCGGGATCGTTTGCGCGTTGCGGAGGAGGTCCTCGCGGAGGAAACCACGCGATTACAAGCGGAGATTGCCGATCTAACTCGTCGT
CTGGCAGATGCAGAGTCTCCGGCGGCTAAAAGGCAGCCGCAGGGGTCAGCACGTCGTCTCGCCACATTACAGGAAGGGTTAGACCAGGCGATCGCAGATC
GCGATCGCGTCGCTTTGGATTTGGCCGAAGCCAACAAGAACCTCGGTGCGCTCGAGTCGTCGCAGCGTGCATTGGAGGACGCGACATCTCGACTGCGCGG
TCAGAACGAGCATCTCGAGCAACGCGTATCTAATCTTCAAGCGCAGCTGGCTCAGCAAACAACTCGGGCCAAGCGGGACTTCGATCGGGTTGACGCAGAG
AGGGAACAGTTTCGTTCTCGTGCAGAGGCCGCTGAGGCCACTCTCCAGACCACGTCCAAGAACCTGCGGCGGGTTATGGCCGATCGCGATCGAGCGTTAG
CTGACCGCCGATCAACTCGTAAGTCCGCCTCGCATCCGATAAATCTTTCGTGCGTGACACTAACATTGTTCCTCTATGTATTGTACCAGAGATCCAAGTT
GATAACGCGCGGGCTTCAATCGCGCGATTGGAGCATGGCCTGAAGGCTTCGCAGGCAGATCGCAGCCGCATCAAGGCGCTCAATCACGAGAATGAGTTGC
TCCTTGCTGACTTGGCCAACGCGCAGTCTGCGTCTTCTGCTCTCAAGAAGGCTTGTGATCGTGCTGTACAGGACCGTGATCAGCTCCGTCATAGGGTGGC
GGGGTTGATCTCGTTCATCCAACCCGCGCAAGACGAAACGCCACTTTCTTCCTCTTCCAAGTCGACGCCTGCCGCATCCAAGAAAACGGCCAAGCGACCG
CGCGGTAGTTCTTCGGCTGGCAGCTCAAGTCCGCCCCGTAGTCGTCCGCGACAGCGATCCCCTAAACCAGTGTCGGAATCAAGTACTGTTCCGCCTTCTC
ACGGTGGATCTGCTTCGCGATCTCTTTTCCTTTCGGGACCGTCAACTCCTAACTCCGGCAGGCTCTCTGGTGGCGATCACTCTCCATCTCAGCGGTCACC
ATCGGTTAACGCCTCCCCGACCAGTAGTGACGACGATTCTCTGTTGGCGGCTCTCGCAAGTTCGCGATCGTCCGGTCGTCGCCGTTCGTCTTCCACCGGC
AGCCTTAGCGGTCGATCATCCAGCCGCCCCATCGACATCGAGTCATCCAGTTCTTCGGAGGCTTCGAACCAGGATCCTGATCAACTCGAAGAGTTGGAGG
ACGACCCTGGCAGTGCCTCTTCCGGTGACGAGAGTGATGGTGGTGCGGACAGTCATTCGACTGCGCCACGTGATTCCGATCGTGGCAACGAGAACGACGG
TGACAGTGACGGAAGCGTAGCTGATGAACCGCGGGCGCACCGCAATCACCTACTCACGCAGGTCGCCCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGT
GCTGTCTGGATCCCTGGATATCGCGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGCCCGTGGTCGGCGAGCACTTTGAGCCGGGTCAGTGTCTTGGAGA
TGGACATCGAGTTGCTCTTTCACCACATGGCAAAGCCTAAAAACTGGCTTTTTCCGCCGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCT
GATCACCGAAAGCAACATTGCGGCACTTTATGCGACGACGCCGTGGAATTCTCTCAACGTCTTGGTGACGCCTTTATCTTTTGAGGTGATTGGTTGGTTC
GAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGGGAGGCTACGCACGCGTTCATGATCAGCTCCACGCTTCGTAAAT
CGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCAGAGACGATCACGTTTCGGTGCCGTCTGGAAACGCTTCCTCAAGTTGATTTTGCAAGGGAT
GATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCCCCGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGATTGT
GGTTCTCCGCCATCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGGCT
CCCAACTGCCTCGCCTCACCGGTAAATTCTCTCTTGTCGCCGACTAAGATGAGGTAGTTAGTGGATCGTATGTCTTCTCAATATGGTCCCCACGGCTTCT
CCCTTCGTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCTGATCGAGAACAGCCGTCCCCGATCTACACAACAATACCACATAGAACC
CTTCCACCTCAATGTGCGACCACCTCGCACACTGTTCACACCACTCCTCCGCCCGCAACAGCCAGCTTGCTACGAGATCTCCTCCTCCACCTCGTGCGAC
TGCATCACAGTGAAGCGATTCCGGTTGACGACTCCTCGCTCGTACTCGCGTAACAAGGCTCCGCAATTCAGATCGGCTTCATCAACCCACGAAAGCTGAT
CGTAACCCTTCCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTTCGTCGGCCTGATCGCATATTCACGATCTTTTCCACCTCGAACTCGTC
CTCATCGAGACCGGCTTCCCAGCTGTCCTCGGGTAAAAGCGCCTCATCAAAGTTGAAGCGATCTTCTTCGTCCACCACCAGCGTCAGCGTGGAGCGATCA
GGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTTCCAACCTTGCTGCATGATTGTCAAGCA
TCTCGATCACTCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGCGCATAGCCCTCCTTCACGCGATCTAGGTACAGCCACACTTGCATATTGGCCTC
AATCCCATGAGGTCGGACCTGATCATTATGCCCGTCTGCTCGTCCTTGAATGGCCTCCCGCAGGGACTCGTTAACCTCTTCTCTGGCTCGACGATAGTGG
CTCTGTATATGATATCTCCACCGACGCGGGTCACGATCCCGTCGGCGCGTGCTTCCGAGAGGTAGCGACGCCTCTAACGTAGATCGCGGGTCCCACCCGT
GTATCAAGTAGAACGGCGTGTCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCGCTCGGCGTACTCATCCCAGTCCTGTTGGTTGAC
GTCTGCGACATACATCTTCAGCGCGCGTGTCAACGTTCGCACCATCCGTTCTGCCGTCACATTGGTCTGCGGTCGATAAGCCATAGTGGCCCTCTGTTTC
TGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGC
ATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTTGCTTTAGCGATCACATAACCCGAGAACAGATCTACCCAGATCAACAGCTCCGT
ATTGCCTTTGAAGGACTTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGGTT
GATGAAGGCAGACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGAAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCGGT
ATGCGGTATGGTGCGATCATTTCGATATGCGATCGTGGCCACCACCGCGATCGCGATCCCGATCGCAGATGGCGATCGTGACGTACCACTTTGGTGGTAC
ACCCGCAATCATTCCGGAAGTAAAAGATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAAGGGGGGAGGTAGGAAGCTGAGGTCATTGT
TGCTTTTTGCTTGTTAGTTTTACCTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGTTGGGAAGTATATTGGCCC
TCCTGACGACTTCGGACTCACCTCGTCGCGCAAGGTAATCACACGGGAGCCCCTGGATCGCTTTGGCCAGGTGTGCAACCACATAACCCCCCCCCCAGAA
GACCCCGCCATAGGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACGACCGAC
GACCGCGTGAAGAATACCCGCGTGGCCGTCAACCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTG
AACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGC
AGTCCGGGCGTACCGCTGGTGAGTTTGGATCGCATCATCCATTTTTGCGATCCCACTCCACCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACA
GGGATTTCACCGTGAGTCCACAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAA
GCGCCAGGATCCACTGATCGTGAGAGTGCCGGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCT
CCCCAGGTCCCCTCGGGGACCCCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCA
CTCCTCCAGTTCCGCACGCAACCTCGAAGAAGAAGAAGGCGAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCG
CAACACGTGGACGGACGAGCAACTGGAGTCTGCCTTCTTCTACACGGACCTGTACAAGTTCCTGCACGAAGATCCTGTAATGAAGATCGTGCGCCCGAAG
CCAATTGGGGAACTGCAAGGTCCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAA
TCGTGCTCGGCTCCTTCGACGCGAACGAGCTATTCGACTTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTG
TCGGTAGTGTCGTCCCGGTTCAACGTGAAAGACCAACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGA
CAGCTCGATCGAGCTGCAGCGGATGACACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCG
ACGAGCGATCCAGCCCAAGCTCCCCGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCAA
CCAAACCAAGCCACCTGGAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATACGATCCGGATGACCTG
GGTGTCGACGTTACCCCTCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAAC
TGAAGGAATTTCGGGAAGGACAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGGCGAGA
AGTGTCTGGTGTTTGGAGATCTGCTCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGACGCGCGGCAACTGGAAGAGCTTGTCTAAGAA
CTTCCAGACTCAATACTGCGGACGTGGCGTGTCTGTCGCGAGACAATACTACCATACGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGCACCGT
CTGAATATCGCCGGTCTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGGCGATCACTTCATCGAAACACTCGACGATC
GCGATCTAGCCAGCCAACTGGCACTGCTAAGAATTCCGGACGCAGACACTCTCGAAGAGACACTGCGATCCCGACAACGTGCGAAGGCGAGACAAGGAAA
GACGGTGTATGGGTCCATCAAACCCAAGCAGAAATCACCCACGGGGATCACCCCATCCGCGAATGCTCGCGCAGTCCGCGCAATCCGCGCAACGGTCAAC
TCGAGCGACTCCGAATTGGAAACCAGCGGATCGGAGAGAGAAGGAGGCCTACGCAAGGTGTACTTCGCGGCAACGCCCGATCAGCCGACCAGATCGCATT
CGGATCAGGAGCAACGCCGTCCTAGTCGAGACTCCAACGACCGTCGCCTCGATCGTCCAGCCGGATCTCTCGAGGGAGAAGCCCCGCGGAAGCCATGTTC
CCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAATGTGGCAAGAAGGTCCACCCGACCGATCGCTGTCTCTTC
GTCTGCAAGGCCTGCGGCGAGATTCACGGAGCCGGAGAGTGCCCGATGGAAGAGTTCTACAACTTGATCCGTCAATGGTACAACCCCACCAAGCACGGTG
GAATGCTCCCGCAAGCGGCTGAAAAGATGTTAAACTAGAACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATAT
GTCGAAAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACGGACAATACATGTGACCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCC
ACCAAGTCGACGAGTATTCGCGATCAGAAGTGACGATGGCTCTGGATCTCCTGCACGGAGAGTCGCGAGGATATTGGAAGTACCATGTGCCAGACAAGAA
ATTCCGGCAGGCGAAAGCCATGGGGAAGATCAACAACGAAAGAGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCT
CGTAAGGTTGGGTGCTACATAGACAACAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGATCA
CGCTCGCTGGATCACTGGTGTACTACTTCGACGCGTGGGTTGGTCCGCCCACAGGTGGCCAAGACTTGATCCTGGGGATGGACTTCATGGTGCCAGCTGG
CATCCGCCTCGATCTGGCTGATGGATCAATAAATCTTCCAGACGAAGTGCGTATTCAGCTAGCCGGCCGACGTCAACTCTACGGAGAGAAGATCACGCAG
GTCAAGCTGGGAGAACATTGCCAGTTGGAAGTCGGAGAGTCGATCGAGATTCGGAAGGGTTTCATCTTGTCGAACCACCGGAAACTGTGGGTTACTCGAG
GAGATAGATGGGTACCGAGTCTGGTGACAGGGTTGGGGAAAACTCGCTATCTGAAGATCACGAATATCAGCGATCAGAAGTTAGTATTGCAAGACGACAC
CCATGTCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGTATGCCGAGTGGCAGAATCTAGCTTTC
CAGTCTACTACAGACCGTGTGGAGGTAGAAGAGCATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATCCTGC
GTCGTGACCGCGGAACCTCGAGATCGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAACAGAGGGGTCTCCAAGGGATCAGGA
AGGTGGCACCGGCGATCAGGACGCGATAGAATCTCCGCCAATGGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAAGGAGTCTATGCCCCAGGCC
GAAACGCCTCCGATCGTTGATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAGATGG
CAATCTTGCCGGAAGTAGTGACCACCACCGAGGAAGTCACGATCGAGGATATCCAGGTGGGCGATCCTGAGTCAAACACCCCGGAAGAAATCGATCGCCT
GCGGCAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCATTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAGGA
GCAGCTCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATCACGC
CGTCAACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTTTGAC
GAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACAAACTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCTGG
GTAGTCTCCATGACAGAACGCGCACGAAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAATGCGC
CACAGATCTACCAGCGATTGATTGATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAACCGATCGACGTGTTCGATTCAGG
CGAGCCAGAACCAGAGCCGAGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGAGAAG
GTTGAAGCACTGCTCGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGAAAAGTGGACTACTTGGGACACCGAG
TGTCCGTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGTAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTGGAAG
TTTGAACTACTACAGTCGGTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATGGTTCAGCAGAAT
AGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGACGCTGACCGCTGGGCCCGAGCGAAGATCGCGTTCACGATGCTGAAAG
CCAGGATCGTGTCCACCCCGATCCTGAAGCATTTCGACGCAGATCGCACTCCAGTGATCGTAGTTTACGCGAGCCAGTGGGCGATCTCCGCGGCTCTTGT
ACAAGAGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATCGTCGACAAGGGAGTTTTGGCA
CTCCTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTCGGCTG
GCTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAGATTCTGGGAGCGAT
GGCAGCAAGCATCACACCTCGCGCAGAAGTAGACGAGGCGTTGATCGCGATTGCCCCAGTAAAGCAGCCCCGACAGACGATCACCATGCCACCCCCTACG
GTCGAAGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCTGCCGG
GATGGACGATCGTCACCGCCGCATCGGAGTATGTGCCCGATCTGACTGTGAACGAGGCGGAGTACCGCGGGTTGTTGTTATGTTTCGATCTGCTGTCCAC
GATGGACAGGGGGCAGATTGGCGACTCCAATTTAGTTATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTGTTGCGCGAGAAA
GCGATGGATCGGCTCAGGTCGTGGCCAGAGCACGAGTTCCTACACATGAAACGAGATTGGAACCAGAGTGCAGACAAGTTAGCGAGTGAAGCTCTCCAAC
GGGGGCGAAGGGATCGTAGTCACCTCAGACGAAGATCAACAAGACTTGATCACGCTCAACCGTTTGGACGAGCTCCTCAAGATGAGGGACGACGATGCCG
TCGTCCGTGTGTCTGCTGTGACCAGATCGACGCGACGCAGACGACTGACTCCTGAAGTCCTGCAAGAAGCGATTATACAGCGTATACGCGGTGAGCGAAT
CATCCAAGCACAGAATGAAGAGAAGTGGATCATCGATCTGAAAGCGTACCTGAAAGGGAACGTCGAGGCTCTCACCGCGGCCGAAGCTAAATCGTGTGCC
AGGGTCGCGAACGATTACGAGTTGGACGAAAACGATCTGCTGTTCTATTGCCCGTCAGCCATGCGGCAGGAAGAGGGCCGAGACGAGATCGCGAAGCTGG
TGGTGCCTGAGACCCTGCAACAAGATTTCCTACATCATTACCACGCAAGTCTGGAAGGGGGACATCAAGGGATCGGAAGGACGTACCGACGAATCCGATC
ACACTTCCACTGGAGGGGCTTATACCGAAGTGTCCAGCGCTATGTGGGAGAATGTACAGATTGTGAGACAGGGAAAGGCCGACCCTTCGTGAGAGGAGAA
TCCCCTGGGAACGTGCAAGCGACGTACCCGTTTCAGATCATCGCTATGGATCACATTCCGTCGTTGCCTAAGTCTGTGGTGAAGCGGGATCACGAAAATT
GCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCTT
GTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGA
ACTGGGGGTTGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGTGTCCTTGGG
TGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCCGTGTGA
TTACCTTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCACCTGGAATAAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCT
TCTTCTCTTATTAGGTAAAACAACAAGCAAAAGCAACAATGACCTCAGCTTCCTACCTCCCCCTTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTT
CCACAGATCTTTTACTCCGGAATGATTGCGGGTGTACCACCAAAGTGGTACGTCACGATCGCCATTTGCGATCGGGATCGCGATCGCAGTGGTGGCCGAT
CGCATATCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTCCATACCCCTACCCCTCAGGTC
CAATTTAATCCCTCCAAAGTCTGCCTTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAACA
TCCACTTCACCACAATCGCCCCCTGTACATGCCGGGGCTGCCCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTATCGCTCCTCGCCACCACACCT
CCACAGCACCATGTCGGACAACTCTTCGCCGGATCAGGGGCGTTCCCCGAACGATCCTTCTTCCCACTCGCCTACGCCCGCCTCTTTCCCGATCTCCTTC
ATCGCCGCAGAGGGCTACGACCTCGAATTCGTCCATCGCTGTTCCTGTGGCTTCCGATGCCACCGTCACAACTCCTGCAGCTTTCTCCGAACATGTACGC
CGAATCGAAGGTCAACCTGGCGATCTCTCGACCGAGTCGTTGCCTCAAGCTGGTTCCTCGTTGCCGCCCTTAGACCAGATCACCATCCGGAGATCGTTGG
CTGCAGTCGAAGCCGCTCTGGATCGCGAGAGTGAGTTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAACGTGT
GGCAGACCTGGAGCACACAATTCGTTCGGCAGCTCAGTCGGCGTCCCCATTCGTCTGCTTCGTCCAACAGAAGTACGATCAGCTGTCCCATCGTCTCGCG
CAGTCTATCCTGGACTTAGCGGAAACCCGAGAAGCTCTGGCCCGGAGACTCGACAATGCAACCGAGCTCACCAACCTCCGTGATCGTATGCGCCTCCAAG
ATCAGTACACGCGGAAGCCGTCGCTGACTTCCAAAGGGAAATCGATGATTTGGAGCGGCGTCTAACGGCTGCATTGGCAGTTGCCAGCACGACTTCTGGT
GACACAGCTCTGCCTCCGTCTGGGGTCAACCCGACCACCCTTCAACTCCAATCCCAGCTGAACGTGGCGATCGCAGCCCAAGGTCTAGCGAACCGCGATC
TGGATCAGGCCCGCGACTCAATTCGCGATCTCGAGACCTCCCAGAAGGCTCTCGAGGGATCGGCGCAGATCCTCCGGCAACAGGTGGCGCTACTCGAGCG
TCGTGCGTCCGAATTGCGCGACCAGTTGGCGCAACCCGACACGGTTCCCGGCGTGCCCTCGACCAGAGTCTTCAGGAACGACAACGGCTGCAGGACCTAC
TGGACAAGTCCGACCAAGATCTAAGCGATCAAGCGGCGAAACTACAACGGGTGACCCAAGAACGTGATCGCGCTCGGAACGAGCTTTCACAAGCACGTAC
GTAATCGCGTCGATCCTTCAGCGTCCGTTGATCTAATCCCGTTTCTCTTTCTTGCAGGTAACCAAGTCACATCCGCCCGCCTTTCCATAGCTCGGCTGGA
GCAGCGAGCAAGCAGCCTCCAGTCTTCGGTAGCCGCCAACCACCAGCTGAGCAGCACTAATGCCGTGTTGCGTGCTGACCTCGCGACCGCCCGTCAATCC
CAACAAGATCTGGAGAGCGTGCGTGATCAGCTGATCACAGAGCGAGACGGTGCTTTGCGGCGCCTTTCGGACATCACCAGCATACTTCAACCTGGCTCGA
TCGTTCCTCCGGCGACTCCTGTTCCCACGCCAGCCAGCGATCCTTCCCTGCTGAAAAAGGGTTCCATCACGGAAACGTCTCGCCAGCCGCTCTCCTTCCC
GTCGCTCTCCATCAAGTCCGTCGTCTCGTCGCAAGCGGCCTCACAAGTCTCGACGTCGCCGATCTCCTTCATCCGGCGACAGCGACGATGATGACGCTCT
GAACGCCGGTCTCGCTCGATCGCGTTCGTATGGTAGACGATCACATTTGTCCCGATCGAAGCGTCGCACAGCAGGTACCCCTAGCAAGCCGATCAACGTC
GACTCTTCTAGCGATCGTGGATCGGATGGCCAAGCCAGCGACGACGGCAATAACGACGATGGCAGTAACGCTGGTGACGATGACCGCGATAACGACGATG
GCGGTAACGCCGGTGACGGCGACCACAATGACGACGATGACGGTAACGACGGCGACAGCGACCGCAATGATGGCGGTAACGACGGCGATAACAAAGACAG
CGACCACGAGGGTGACAACGACGATGACGGCGGCGGTGACGGCGGCGGTGATGGCGGTGACTCGTCCGGAGGCAGCTCCGCCGGCGACCACCACTCGGGC
GATTCCGATAGCAGCGATTCAGCGAACTCTGTCTTGTCCGATGCCGAGCTCGATCAGCTCGATCCCACCACCATCTCTCGGGACCGTTGGATCCCAGGGT
ACCGGAGTCCTGTAAGGTTCGCGGGTACGGACGTGGACCCTTGGCCTCTTTCTCCGGTTCGTCAACTCAGCGTCCGCCATTTGACGGTTGCTACGTTATT
TCGTCAGTGGAGTCGTCCGCCATCTTGGCTATTCCCGCGTCGGACCCGCACTCCTTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAATATC
TTGGCGTTGTATAAACTGCGACCATGGATTGTGTTGGGTCGGGCAGTTCCGCCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGT
ACGCGGCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACAAGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAA
GTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCAGACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGAT
CTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAACGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACT
TAATCAACGCTCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAATATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGA
CGGTAAGTTTCGGTCCATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGGTCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTA
TTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCT
TCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCC
TCGTTCAAAGTCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGTGGA
CTCGTCCGTAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAG
GAGGGCTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGGCGCGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCA
CGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGC
GAGCTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCCACCGCGATGTTGTGGGGTCGCAGATCTTCGTTGTGTCGGTTG
GCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGAT
CGCGTCTGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCCATGGGCCAGGTAGAAAGGCGTGTCACCACGAACTCGATC
CTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTAGAGTCT
GCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGA
CATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCAGTGCGA
GAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGT
CCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTC
TCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACGCGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGG
CTAGCGTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGC
AGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAG
GTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGC
ACTCGTCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGA
TCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTT
CATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGC
ATTTGCCGGATCACTAAATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGAAACACAACACAGTCCGCGGTATTCAGC
TTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGT
TTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCATGGTGATCGTCTGTCGGGGCTGCTTCACTG
GGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGAT
CTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGC
ACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGG
GCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGAT
CACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCA
GCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAACCATCTCGTGGAAATCCGCTTCGCGCAGCTCGT
ACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGG
AAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCACTTTTCGTCGGCCCCAGAAACTTT