Description :
From Genome Similarity Track
Location :
Scaffold_79:49337- 51386
Transcript NameFunction/comments
Albla_Nc14059500

Sequence
2049 bases(100 bases per row)
CATCCAACTTATCCAATTTGCGATATCGACACGAGTTTTCGCGAAATCCAGACCGTCCGTATTGAACACAAATGGAGCTAGAAGCCAGCATGCTCCCAGT
AGCCAGACCGCAAAAGATGCGATACCATAATCCTGGCCTTTACTTCCATATGAATCTAGAAGCGTGACATTCTCCGGAATGCTTTTGTTTGAATTATTGC
ATGCGTCCTGTGGGATACCACTTGTCCGACAATAATCCTCCAAGGATCTTGTCCCGATCGAAAAGTGGCCGAAGATACCAAACAAAATCATCATTCCAAG
CAGTTCCATTGCTTTGCGATAATGTGAGGCGGCATACTCCTTGAAAAAAGACACAAGTGTCTCTCGAACAATCGCAAAGCCTCGACCTGTACCTCGGTAT
TTGGACCCACCACGCATCAACGAAACATCGTAAAAATGAGCTTTTGTTCCCGTTTCGAAAATGTAAAAGACCGAGCCCAAAGTCACCAGCAGCTCGATAA
ACTGTAAGACGGCTTGACGCCAGCCAAACTCGACAAATAACGTTGCCACGAGCGGAATCGTCATCAAAAGCCCAAACTGGAAGATGAACTGTGTGTTCAG
TGTTTGCGCAAGATTATCCAATCCATCGGTTTTCGTAATAGCGGCCAACTGAACGTCCTCATGCAAAGAAATGTACAGCTTGGAGTACGCGTAGCAGAAG
ACACAGAGCACCGTCAAAGCGTTGCAAATGTAAAAGCCCATGTGCCCATAAAACATGGAATTTAGACGAAAGAAATCCATCCCTCGGCCCATTCGATACG
CATCGCGACTTAATGAGGACTCGGCACAGCCGTTCGCCAATTTGGCTTCAAAGGCATTGATCTGACTCAACGTGACGTCTCGTCCTTTACCACATTGCAT
GAACTCAATATGAGTCACCCGACCTCCACGAAGCGCTGCATTGTACCCGCTAAACACGTCCTCGGAGAGATTGATACCTTTGCTTGCCTTGGAAACACCT
CCATTCGATATGACAAACGATTTATCGAATACGTCTGGATGGCCGTAATGCATTCGACTTCGAAGTGGATGAGCCAAGACACGCTGCGTAAGGCTGACAA
AAACAAGCTCTTGTAGCGTCATAAACTGAGCCAGGCTGGAAGCTCGTCCTGTGAAAATATGTTCCTTCATCCCGATGATCTTTACGTTTGGATCCTCGCT
TGCCGTGGCCAGAAAATTGCCCATTTTGAGGGCTTCTTCAAAGTAGTGCTCTTGATTCATGTCAATAGTTTGCACATACTCTCCGCGAGTGAATGGTAAA
GCTATATTTTGGTTTTCAGGCTTTCCTTCTCCGATCATTGGGTTCCCAGGAAGCTCATATCGATACACCTCGACAATTTCATCGCCTTCTGCCTTGACCA
GTACACAGTCGTAGCGTATCTTGTCGGGTAATGGAATGGGGTCAACAAAGCTCACGCGCCAATTCGGATACTTTTGCATCAAAAGATTGATATCTTGAGC
TCGTGGATCGCGTTGAACGACTTGCTGAGAGTAGAGCTGACAACTTGTGATGTAGGTGAATTTGAGTCCTGCAATCGCTTCCATTGCCCGAATCTTATCC
TTGTGTGAGAAGCTAGGATCGGAGCCGACCTCGAGCCATCGAAGCATTCTCAAAGCATCTTCATACATCATGATTCCTTGCACCGTTCGAGCGAGTGTCT
GGCCTCGGCTCGAGGCCCAAAGACGCACTTGAGTCGGCATTTGAGCTAATGCTTCTTCCATACTGGTCAACCCAACACGTTCTAGAAAGTTACCCCACTC
ATCGCTATGAAAAGTGACAAGATACTTCAGGATGCTCAGATCTCGATCTTTGTGCTCCACCTTGCGGAATAGCGGATTCGCATTGACTCGACCATGCAAT
TCTTCGATGGAGTAAAGCACGGATTCATTATAGTAAGGTGTGATGACGGAGAACGATTGCATGGATGCAATCGATGGAACGGATGGCATTTCCATTGATA
AAGAATTCAGGAAGAAGCTCATTCGACGCTGAGCCTCAGAGCATCGAGG