Description :
From Genome Similarity Track
Location :
Scaffold_11:493305- 496002
Sequence
2697 bases(100 bases per row)
GCTCAACTGACTTATTTTGTGTCGGGCATGGTCGGGCATTGATCGGGTGCTGTCGGGCACCATTAGCCTGTCTCTTCCACACCAGTCGGGTTGAATAGCA
AGTGCCTTGATTTAATGCAAAGTCCACGGCTATTGCCAACTCTACCTTCATCATGATACACGCGAGCTGCACAGCACAAGCAAAACACACGAAATCGCTG
TCGCACACACCACCCCTGCCTTCACTCTCCTCGTCGCGAAGCTGGAGCTCGCGGCGTGTCTTCTGGCGCTTCCCCTCTTTCTTGCCCGGGCAGCGCAGCA
CGACGCGCTTGCCCTAGGCAGGTGGAATCGCTATCCCACCGTCAAAGGCATCGTGCCAAATTTCGAAGCACGTCTTTGCCATGACCTTGTATTGACGCCG
TATCTTGTTGCACAACCAGCACTTAGCATAATTAACGGAGCAGCGCACGCAAAAGAAAGCCGTGGCGAACGACTTCTTCTTGGGGTCCGAGCGCAACAGC
ACGCACACCGTGCATGAGCGCCGGCGGCGCTTCTGAACCCCGCTGACCGTCACCCAGTCTTTGGCTTGCTTCAACGCGTGAATGAGACGGACGGTGAAGC
GCTTGCGCTTATTGTGTCGGTAGCCGGCGTTGCGATGACGCCGACGAAGTCCTCGACCTTCGGCTGAAGCAACTGGCTCTGCAGCACGGAGTACCTTTCG
GCGCGCTGCATCAGCGTAGTTCCTGGGGCGATTTTGGTCATTTCCTTGTGCGAGATGTACGCGTTCACCAACGCGAGCCGAGAAACAAATTTTAAAGTAC
TTGATGATTTTGGTCGACGCTTGCAACGAGTAAGACAAGAGGCGGACGGATCGTGCACATCAACTTCGCCCATCCAGCGCTGGTAGTCTGTCACCGCTGC
CGGGCATGGATCTGCTACTGATGAAGCCTGTGGCGCCATGCACGAATAAGAAATTAAGAAGATCCAACGCGGAGAACACGAACGCGAGATATCTAACGCG
AAGAAGAATGAGAACAATTTGATTGTTAATGCTAAAGGAAGTTCGACGCAGAGAAGCCTTGGCCTTGTGACCAATTGAGGATTCCGACATAACTGTACCC
GTGCACACGTTGTGCACAGACTTGCGGTCCCACCTGTGAAACTCCACCATGGTGGGGACCCGGAAAAACACGAAGGTGCCTCGCGGGAAGCTGGCTGGTC
TGGTCGAGCGACTTGCCTTCACGTTGACATCGTAGTCTAAGCGGTTAGTCATGGTGGTGCCGATGACGTACACCTTCATCTTCAACAGCTTAATCGCCAA
CGAGACCGACGAGTAGACCCTGTCGATGCCGATCGCATTAAACGCATTTCGACAGGATCCGAGTACAATCTTGGCGGTGCCTGTCTTGCCGACGAAGTAG
TCATCGCCTTCGCCGCTTTAGCGCTTTTCAGAGAACATCTCGAAACTAGTAAGACACAACATAGGATAGCAAAACATAAGACCAACGTCGTAAATAATGA
CAAACTAAACAATGCAATAAAAAGTACCGATGGCAATAGGCGGCCCGCGAGTCACAATCTTTGACCCGTACCTGTGAGGTTTGTCCGGCATAAACATGCG
TGTCGTGTTCCGCTTGGAGGTAGCCGCTAACACACCCTCGTCGAATGAGAACACCGCCGGCTGCGACCGCCCCGCCAAGAATTGCTTCTGCAATTTGTCT
ACGACCGGCCGCAGCTTCCACAACCTGTCTCGATTGCGCGATCCCTCGTTGTTAACTAAGTGGAGATAGCGAAGGATGTCCGTGCAGCGATTTCTGCCCA
TGTTCTCCGCAGACAGCGCGCCGTCCTCCACCATCGTCCAATGCGCGCCAAAACGGCGCTTCCGCGGGCACAGCATGCGCGGCAACAAGCAATCAAGTGA
CGAGCAAGATCTTGTGGGTTTGTAGGCTGGCGTCGCCCTCAGACGCCGTCGGATCTGAGTCCATGTCTCGCGTCGACGCAACTTGCTTGGACTGGATCGA
GGCAGCTCGGCGGTTGACCTGCTGGGGACCGTATCTGCTGGTCTCCGTGTTGATGAGCACCCCCACAGACTGGGGCATGAAGTAGAAGAACATCTTGAGC
GACGAGTCGCACAGCGCACGTAGCTTCGGCACCGGTAGGACCTCTTCAGAACTGAGGCCTATTTACGCTGGTGTGTCGCCCTCGAGCACCGAAGACACAG
CTGTCCAGTTCAACGCGCGCAATGTGCTCTCCTGTGCCTTCTTTGCCTGCTTGTCCACGAAGGCGCTGTTAATCTGCAATGTCCCGATGAAGGCGGTGTT
CATATGGACAGCGTCGCCGTTGGTGATATCGCCTTCCTCCTCCTCGAAGTTGCCGCGCCGGGCTGTCTTCATTCTCAACAAACACTTCTCTTTCGCTCTC
TCCGAAGCCGCCTTCCTCGTAGTCACGTAGAATCTCGTCGCCAGGGATAAAATTGACGTCCGTTTTAACTCGGACACCCGGGCAGGGCACTTGAAGGGGG
AGGTACCATCACAAGAGGCAGTAGCGGGCGGCTCTGCTTCACCATTCAGGCCCGATGTCTCTACATTCAGGTCGACCGCCGACAAGTCAAACACCAGTGG
CACAGTAGCCTGTGAGAGCTCGACGCCTGACTCGTTGCCAAACAGCGCGTTTAATGTCCTCTGCGAGAGCTGCACGGTCGTGTCGATATGCGATACA