Description :
From Genome Similarity Track
Location :
Scaffold_22:49321- 50684
Transcript NameFunction/comments
Albla_Nc14026170conserved hypothetical protein

Sequence
1363 bases(100 bases per row)
TCGTATAATCTCTTTATACGCATATACTCTTGCCGATATTGATTTTCAATGATTGAGACCTGACGGAAATTGTCCCATTCTGGAAACTCTTTGAGCAACA
TATCGACATCATGGCTCAGTGATAGCTGTATCCCTTGACTCAGATCATTCAACGTTGTCGCCAGATCGACATGACTATCACCCAGATACTGACGCTGTAA
GCCAAGCAGCTCATAATTGCTACGGACAAAAAGAGCGGTACACTCCATAGAGCTCTTGGATTCAGCCTTCAGTATACCTTCATAGCAATCTCCAACAAGC
TTGTACATTCGGATGAGCACAAAGTGGTCGTGCGCTACAATTTCTAATGCATCGGAAAGAATATCTAACGCTGTGTCTAAAACGTGACTTGCACTTTTCT
CTTTCCGTGTGGCAAGCACTTCGCACCGAGAGACACGATCTTCGATCTCCACCAGCTGTACTTCTCGATCGATCAGTGAAGTGGAAGAGGGAGCCTGGAG
CTCAGAATCACCACGCTGACATAAATTGCACGTACACTCAAATCCAAACTGATTTTTCAGTATTCGCCTTCGCTGTAAGCGAGGTTGTTCTCGAGGATAC
AGGTACGATATGGTCAGTGGTTGGCCTTTGCAGATTCGTTTGGTCACACGAACTTGAGAAATGGAGTCATTCGACTCAGCGGGTATGAATTTCACGCAAT
TTGGATTGCAATCGTGATTCAGCAGAGAGCAATAGAGAAAAACTCCGCTATGAAATGCATTACATTGCATCGAGAATATGCTCTGAAGCAAATCGTCCTC
GATGAGATTCTTTTCGGAGTACTTTGTGCACAATTCCTTCAAGATACAGGAGAATTTATTGCGTCCTGCATACAGCAAGTATGTTGGTAGGTCTTCAAGC
GTCCGCGGATACAAATGGCCAAGGTCTTTCCGAACAGATTCTTGGTCGGAGTGCTGTAAAATGCTTTTCAAAGCTTCAGCAAGGAACAATGGATCGTCCT
TTGTGGCGTCATTTGGCCACGGTACATGGACATTTTCCATCAGGATGAGTGTGCCTGGCTCAAGATCCTCTGTGGCAATATACCCTCTATGGCCACCGAT
ATCCGTACAGTCGATTCTTAATCGAATCGAGTTGGAGTACAATGGAGGAATGTGTGGCCACGGAGAATGGTCGATCTCAAAGCTTTTCTTATCCGTATCC
AAAGCTTTGATCGTATCCATTGATACAGTGGGATCTATGTACAATATGCAGCTTCCAGATTTTGTTGTTAAATGATCGCTTTCGCTGTCGCTATCATCGC
CATCAAAGAGATCGAATGCTTCCTGCACCGCTGACGATTGCGGCATAGTGGCCAATCAATGCC